Table 2.
Designation | Sequences | Conditions (cycle number) | Message size |
---|---|---|---|
18S | +: 5′ TCAAGAACGAAAGTCGGAGGTTCG 3′ | 1 minute 94°C | 475 bp |
−: 5′ TTATTGCTCAATCTCGGGTGGCTG 3′ | 1 minute 62°C | ||
1 minute 72°C | |||
(28 cycles) | |||
OPG | +: 5′ GCTAACCTCACCTTCGAG 3′ | 30 seconds 94°C | 324 bp |
30 seconds 55°C | |||
−: 5′ TGATTGGACCTGGTTACC 3′ | 30 seconds 72°C | ||
(40 cycles) | |||
RANKL | +: 5′ GCCAGTGGGAGATGTTAG 3′ | 30 seconds 94°C | 486 bp |
30 seconds 55°C | |||
−: 5′ TTAGCTGCAAGTTTTCCC 3′ | 30 seconds 72°C | ||
(40 cycles) |
Primers are represented in a 5′ to 3′ orientation, with that for the coding strand (+) and the non-coding strand (−). The product size generated by reverse transcription and PCR amplification of the authentic mRNA is indicated, together with semi-quantitative PCR conditions.