Abstract
The Methoprene-tolerant (Met) gene in Drosophila melanogaster has been shown to function in juvenile hormone (JH) action. Met homologs were isolated from three mosquito species, Culex pipiens, Aedes aegypti and Anopheles gambiae. Sequence similarity was found to be high in bHLH and PAS conserved domains, and the majority of the 7–9 introns in AaMet and AgMet are located in either identical or similar positions, indicating evolutionary relatedness. Sequence comparison with Met and the similar germ-cell expressed (gce) gene in D. melanogaster showed that the mosquito genes are more similar to gce than to Met. Moreover, the multiple introns in AgMet and AaMet are more similar in number with the 7 introns in Dmgce than to the single intron in DmMet; in fact, six intron positions in AaMet and AgMet are similar to those in Dmgce. Efforts to identify a second homologous gene in mosquitoes were unsuccessful, suggesting a single gene in lower Diptera, consistent with the single gene uncovered in genomic sequencing of Ae. aegypti and An. gambiae. These results suggest that a gene duplication occurred during the evolution of higher Diptera, resulting in Met and gce.
Keywords: Methoprene-tolerant gene, mosquitoes, intron locations, phylogenetic analysis
1. Introduction
Juvenile hormone (JH) is involved in a variety of important functions in insects, including development, reproduction, caste determination, and behavior (Riddiford, 1985, 1994; Nijhout and Wheeler, 1982). Although JH is a necessary molecule at certain time in insect development, it is toxic when present during early metamorphosis in certain insects, especially Diptera (Wilson, 2004). Several chemical companies have taken advantage of this characteristic and synthesized chemical analogs of JH (JHA) having insecticidal activity for certain insects (Staal, 1975; Mulla, 1995; Ritchie and Broadsmith, 1997). Perhaps the most successful JH analog is methoprene (isopropyl 11-methoxy-3, 7, 11-trimethyl-2, 4-dodecadienoate) (Henrick et al., 1973), which is very effective against dipteran insects (Staal, 1975; O’Donnell and Klowden, 1997). However, the wide use of methoprene for mosquito control in recent years is perhaps exacting a toll: resistance evolution. Methoprene resistance has been shown in two Florida populations of Aedes taeniorhynchus (Dame et al., 1998) and in California populations of Ochlerotatus nigromaculis (Cornel et al., 2000; 2002).
The Methoprene-tolerant (Met) gene was identified due to its involvement in methoprene resistance in Drosophila melanogaster. Examination of Met allele phenotypes and rescue by Met+ transgenes clearly showed Met to be directly responsible for JHA resistance as well as its involvement in a JH-mediated physiology, that of oogenesis (Wilson and Fabian, 1986; Wilson et al., 2006). Isolation and sequence determination of Met showed this gene to be a member of the bHLH-PAS family of transcriptional regulators (Ashok et al., 1998). Met is proposed to be a component of the elusive JH receptor, based on the mutant phenotype (Wilson and Fabian, 1986), the binding of JH III by MET, its ability for transcriptional activation (Miura et al., 2005), and its genetic interaction with the 20-hydroxyecdysone primary response gene, Broad-Complex (Wilson et al., 2006). Another D. melanogaster bHLH-PAS gene, germ cell-expressed (gce), shows more than 50% homology to Met (Moore et al., 2000); however, a function for gce has not been reported. Both genes are also present in the recently sequenced and annotated D. pseudoobscura genome and have high homology with those genes in D. melanogaster.
We wanted to determine if Met and/or gce homologs exist in mosquitoes, which might allow identification of the responsible gene (s) for resistance to methoprene in mosquitoes. Using degenerate primers from known Met genes combined with RACE-PCR, we isolated and sequenced Met cDNAs in three different mosquito species. The mosquito Met genes have higher similarity to gce than to DmMet. We propose an evolutionary scheme for these genes in Diptera.
2. Materials and Methods
2.1. Mosquito species
Mosquitoes used in this study were Cx. pipiens (provided by Dr. Rebecca M Robich), Ae. aegypti, and An. gambiae (both provided by Dr. Woodbridge A Foster). The rearing conditions for Cx. pipiens, Ae. aegypti, and An. gambiae can be found from Robich and Denlinger (2005), Gary and Foster (2001), and Mostowy and Foster (2004), respectively. A fourth mosquito Oc. nigromaculis (field-caught specimens provided by Dr. Anthony J Cornel) was included in the phylogenetic analysis. The 4th-instar larva of each mosquito species was used for PCR.
2.2. Degenerate primer design and RT-PCR
The amino acid sequences of Met (GenBank protein accession no. T09462), CG1705-PA (NP_511126), gce CG6211-PA (NP_511160), and An. gambiae homolog ENSANGP00000010697 (XP_316059)) were compared to identify their conserved regions. The degenerate primers were designed using Consensus-Degenerate Hybrid Oligonucleotide (CODEHOP) program (Rose et al., 1998). The forward primer 5′-CGC GAT AAG CTG AACGGC WSN ATH CAR GA -3′ and the reverse primer 5′-CGC ACC TCA TCC GTC ATG TAN CCN GCN AC -3′ were chosen to amplify the Met homologs from each mosquito species.
Total RNA was extracted from fourth instar larvae using Trizol Reagent (Invitrogen). Five micrograms of total RNA were used for the first strand cDNA synthesis at 50°C in a 20 μl volume containing SuperScript III reverse transcriptase and oligo(dT)12–18 (Invitrogen). RT-PCR amplification was performed using 1 μl first-strand cDNA obtained from the RT reaction as template, 1 μl (10 μM) of each primer, 0.1 μM of each dNTP, and 1.25 U High Fidelity Taq DNA polymerase (Invitrogen) in a final volume of 25 μl. PCR amplification was carried out in an Eppendorf cycler with an initial denaturation step at 94°C for 3 min. Amplifications were achieved through 35 cycles at 94°C for 30 sec, 56°C for 1 min, and 72°C for 1 min. A final extension reaction was carried out for 10 min at 72°C. PCR fragments were purified, ligated into the pCR 2.1 TOPO TA Cloning vector (Invitrogen), and transformed into TOP 10 cells. Inserts from positive clones were sequenced, and the sequencing results were used to design gene-specific primers for 5′ and 3′ rapid amplification of cDNA ends (RACE).
2.3. RACE
Full-length Met gene cDNAs were synthesized by 5′ and 3′ RACE (Invitrogen). One gene-specific primer for 3′RACE-PCR and 3 gene-specific primers for 5′ RACE-PCR were designed in each mosquito species (Table 1) using the Gene Fisher software (http://bibiserv.techfak.uni-bielefeld.de/genefisher/).
Table 1.
Gene-specific primers used in 5′ and 3′ RACE-PCR in three mosquito species
| Name of mosquito species | Name of primers | Primers | 5′ to 3′ sequences |
|---|---|---|---|
| Cx. pipiens | 3′RACE | Sense primer | CCTGTACGGGCAGAGTTTGTA |
| 5′RACE | Antisense primer for RT | GTAGCTTTTCGTCAAT | |
| 5′Cx-1 | Antisense primer for primary PCR | GGACCATCCCGTACAAACTCT | |
| 5′Cx-2 | Antisense primer for nested PCR | GGTCTTGCCAAACACGTAGTC | |
| Ae. aegypti | 3′RACE | Sense primer | GTCAGACCGATCTCTACGGCCA |
| 5′RACE | Antisense primer for RT | GACTAGCTCGTATGCT | |
| 5′Ae-1 | Antisense primer for primary PCR | GGGTGAATCAGGTTGAACAGA | |
| 5′Ae-2 | Antisense primer for nested PCR | CTTGCGATCAATCTCGTCTTC | |
| An. gambiae | 3′RACE | Sense primer | TCGATCAGTCTTTGCTGACG |
| 5′RACE | Antisense primer for RT | GCTACTATCACCCATC | |
| 5′An-1 | Antisense primer for primary PCR | CGGGAAGCGCGGAACCGAG | |
| 5′An-2 | Antisense primer for nested PCR | GATTTGCCAAACACATAGTCCA | |
| APa | Antisense primer | GGCCACGCGTCGACTAGTACTTTT
TTTTTTTTTTTTT |
|
| AAPa | Sense primer | GGCCACGCGTCGACTAGTACGGGI
IGGGIIGGGIIG |
|
| AUAPa | Antisense primer | GGCCACGCGTCGACTAGTAC |
: The anchor primers are provided by the RACE Kit (Invitrogen). AP is for adapter primer, AAP for abridged anchor primer and AUAP for abridged universal amplification primers.
After separation on a 0.8% agarose gel, the RACE-PCR products were cut from the gels, purified, and sequenced.
2.4. Intron positions in genomic sequences of Ae. aegypti and An. gambiae
Genomic DNA was extracted using the method of Qiao and Raymond (1995). Genomic DNA amplifications of ORFs were carried out using primer design based on the cDNA sequences obtained from RACE-PCR. cDNA sequences from Ae. aegypti and An. gambiae (AaMet and AgMet respectively) were arbitrarily divided into two fragments and two pairs of gene-specific primers were designed to amplify the separate fragments. We obtained the latter half of sequence containing four introns for AaMet and AgMet and the remaining intron sequences were obtained when genomic sequence data of Ae. aegypti (http://www.broad.mit.edu/annotation/disease_vector/aedes_aegypti/) and An. gambiae (http://www.ncbi.nlm.nih.gov) became available.
2.5. Phylogenetic tree construction
Multiple alignments were performed using Clustal X 1.83 (Thompson et al., 1997). Amino acids at the 3′ and 5′ termini were trimmed, resulting in a sequence alignment spanning the HLH domain through the majority of the PASB domain. Portions of the alignment containing multiple gaps were manually removed. Phylogenetic tree construction was done with PAUP* 4.0 for Windows (Swofford, 2002) using the parsimony method. The eight in-group sequences include Met homologs of four mosquito species and Met and gce sequences from D. melanogaster and D. pseudoobscura. Three bHLH-PAS genes obtained via BLAST searches, Dmcycle (bHLH-PAS gene from D. melanogaster), XlARNT2, and DrARNT2 (bHLH-PAS genes from Xenopus laevis and Danio rerio, respectively), were assigned as outgroups. An exhaustive search produced a single tree, which was opened with the TreeView program (Page, 1996).
3. Results
3.1. Isolation of Met full-length cDNAs in mosquitoes
Based on the conserved amino acid sequences among DmMet, Dmgce, and a partial homologous sequence from An. gambiae, a pair of degenerate primers were designed and used for RT-PCR amplification of a fragment including the bHLH through PASB domains. A single gel band of ~900 bp was obtained from each mosquito species, whose translated sequence showed similarity to those of DmMet and Dmgce.
We used each of these sequences to design primers for 3′RACE and 5′RACE amplifications. After sequence alignment of the products, the full-length cDNA of each species was constructed. The Cx. pipiens (CpMet) cDNA (AY895165) is 3,109 bp in length and contains an open reading frame encoding a protein of 854 amino acid residues with a predicted MW of 93.3 kDa. Before the start codon, there are 94 nucleotides of 5′ untranslated region (5′UTR) upstream. A TAG stop codon is followed by 453 nucleotides of 3′ untranslated sequence, which includes the canonical AATAAA polyadenylation signal upstream from an 18 bp poly (A) tail.
The AaMet cDNA (AY902310) is 3,135 bp in length and contained an open reading frame of 2,727 bp encoding a protein of 909 amino acids with MW of 98.4 kDa. There are 123 bp nucleotides of 5′UTR and 285 bp of 3′UTR sequences containing 20 bp of poly (A) tail. The AgMet cDNA (DQ303468) is 4,782 bp including an open reading frame of 3,348 bp encoding a protein of 1,116 amino acids of MW 119.4 kDa. There are 189 bp nucleotides of 5′UTR and 1,245 bp of 3′UTR sequences including 28 bp of poly (A) tail.
3.2. Sequence analysis of Met genes in mosquitoes
All three mosquito Met genes showed (1) primary domains characteristic of bHLH-PAS proteins: bHLH, PASA, and PASB and (2) sequence homology with each other, being highest (64%) between CpMet and AaMet (Fig. 1). Sequence identity between each mosquito gene and DmMet is 43–45%, and Dmgce is 48–57%. The bHLH conserved domains show much higher identities (70–97%), favoring gce (84–97%) more than Met (70–83%) (Table 2).
Fig. 1.



Amino acid sequences comparison among AaMet, AgMet, Dmgce, DmMet, and CpMet and intron positions among AaMet, AgMet, and Dmgce using Clustal W program (http://www.ebi.ac.uk/clustalw.html).
Asterisks and dots denote perfect and similar identities in the alignment positions, respectively; bHLH, PASA, PASB domains are indicated by underline, bold underline, and double underline, respectively, in the AaMet gene.
Six conserved intron positions among AaMet, AgMet, and Dmgce are indicated as bold and underlined. The other intron positions are all shown in bold. One intron in AaMet is located in the PASA region and is the same position (162Q) as AgMet; the second intron location (AaMet, 243R) is the same as Dmgce, but not in AgMet; the third one (34K) is unique in AaMet.
Table 2.
Amino acids identities among DmMet and Dmgce and Met homologs from three mosquito species
| DmMet | Dmgce | CpMet | AaMet | AgMet | |
|---|---|---|---|---|---|
| DmMet | *** | 50 | 44 | 43 | 45 |
| Dmgce | 83 | *** | 57 | 48 | 50 |
| CpMet | 81 | 95 | *** | 64 | 51 |
| AaMet | 70 | 84 | 84 | *** | 52 |
| AgMet | 81 | 97 | 95 | 84 | *** |
3.3. A single Met homologous gene found in Ae. aegypti
PCR amplification with degenerate primers in each mosquito species consistently gave one band as described and shown in Fig. 2. To determine if a second Met homolog with higher similarity to Met than to gce is present, two pairs of Met-specific primers were designed to specifically target a Met homolog from Ae. aegypti. Two forward primers were FP1 (5′ CCC AGT CTS CAT CTR ACG GAC 3′) and FP2 (5′ ATM GAG ACS CTG TTC TAT CAR CA 3′) were paired with one reverse primer RP (5′ CAG CTG RTA SGG TTC YGG CTG 3′) and used for amplification. However, no band was amplified from the mosquito species (Fig. 2, lanes 6 and 7), although the expected Met sequence was amplified from D. melanogaster (Fig. 2, lanes 4 and 5).
Fig. 2.

RT-PCR results using Met and gce degenerate primers or two pairs of Met-specific primers.
Lane 1: 1 KB ladder (Biolabs).
Lane 2: Amplification using Met and gce degenerate primers in D. melanogaster. Top band: DmMet; bottom band: Dmgce.
Lane 3: Amplification using Met and gce degenerate primers in Ae. aegypti. The single band shown is AaMet.
Lane 4, 5: Amplification in D. melanogaster using each of two different pairs of Met-specific primers, showing the expected DmMet band in each lane.
Lane 6, 7: Amplification in Ae. aegypti using the same primer pairs as in lanes 4 and 5, showing failure of amplification.
3.4. Comparison of intron positions among AaMet, AgMet, and gce
We identified and examined introns of AeMet and AgMet. In DmMet, there is only one intron located in the PASB domain (Ashok et al., 1998), but in Dmgce, 7 introns (none in the PASB domain) are present. The intron numbers and locations in AaMet and AgMet are more similar to gce than to Met in D. melanogaster: there are 9 and 7 introns for AaMet and AgMet, respectively. Four introns are located in the same positions in AaMet and AgMet, and 6 introns are located in similar positions in Dmgce, AaMet, and AgMet (Fig. 1). One intron located in the PASA region of AaMet and AgMet is not present in gce.
3. 5. Phylogenetic analysis
Sequences used in this analysis spanned the bHLH region through the PASB domain, a total of 286 amino acids. The six genes examined (OnMet, AaMet, CpMet, AgMet, Dmgce, Dpgce) were found to form a sister clade to the Met group from Drosophila (DmMet, DpMet), a result consistent with initial observations of amino acid identities among these sequences. An exhaustive search using the parsimony criterion produced a single tree (Fig. 3) indicating that gce and the mosquito Met homologs diverge from a distinct node, which shares a common ancestor with Drosophila Met. An identical tree topology was obtained using nucleotide characters (data not shown).
Fig. 3.

Phylogenetic tree of DmMet and DpMet, Dmgce and Dpgce, and four mosquito Met homologs.
An exhaustive search using amino acid sequences spanning the bHLH through PASB domain produced a single most parsimonious tree. Three additional bHLH-PAS family members serve as outgroups. Bootstrap values from 2000 replications are displayed on the appropriate branches. The Ochlerotatus nigromaculis (formerly Aedes nigromaculis) formed a clade with Aedes Met, as expected.
4. Discussion
Mosquitoes transmit diseases affecting millions of humans worldwide. Vector control by insecticides is still important for disease control. Methoprene has been widely used for control of mosquitoes in the past 25 years (Schaefer et al., 1975). Resistance to methoprene has appeared in Ae. taeniorhynchus (Dame et al., 1998) and Oc. nigromaculis (Cornel et al., 2002), but the resistance mechanism is unknown. Identifying the mechanisms of resistance to methoprene in mosquitoes will aid in mosquito control.
In order to identify the potential methoprene resistance genes in mosquito species, Met homologs have been isolated from Ae. aegypti, An. gambiae, and Cx. pipiens using CODEHOP degenerate primers (Rose et al., 1998). The degenerate primers in this study were designed based on bHLH and PASB sequences to allow amplification of both DmMet and Dmgce homologs simultaneously (Fig. 2, lane 2). However, in each mosquito species, only one band amplified (Fig. 2, lane 3), suggesting only one Met homologous gene in each mosquito species, a result corroborated after searches of the genomic sequencing data of Ae. aegypti and An. gambiae.
High identity between Met and gce suggests that a gene duplication event occurred in higher Diptera, producing Met from a gce template. The similarities in the intron positions among gce and the putative mosquito Met homologs lend support to this hypothesis. It is also possible (though less likely) that the duplication occurred before the divergence of higher and lower Diptera, and one copy was subsequently lost in lower Diptera. Future study of homologous sequences from other dipteran species will serve to further elucidate the evolutionary history of these genes.
Although the function of gce in D. melanogaster is unknown, GCE can dimerize with MET in the absent of JH or JH agonist (Godlewski et al., 2006), indicating some function in common with Met. Since methoprene applied to Ae. aegypti results in toxicity and morphogenetic defects (Braga et al., 2005) similar to those seen for D. melanogaster (Postlethwait 1974), we believe that these Met homologs function similarly in JH action and possibly resistance in mosquitoes, and may have Dmgce function as well. Elucidation of the function of Dmgce will help our understanding of mosquito Met functions. Neither Met nor gce appears to be a homolog of the vertebrate bHLH-PAS aryl hydrocarbon receptor (ahr) gene, however. AHR binds various xenobiotic compounds, such as dioxin, and subsequently transcriptionally activates certain genes, especially cytochrome P450s, involved in the degradation of these compounds (Hahn, 1998). Although the property of ligand binding by MET might suggest an evolutionary relationship of Met with ahr, the resistance studies have shown Met interaction with JHAs, not with a variety of chemically dissimilar insecticides (Wilson and Fabian, 1986) as might be expected for an ahr homolog. Based on gene homology, the spineless (ss) gene of Drosophila has been proposed as an invertebrate ahr (Duncan et al., 1998). Future ligand-binding studies with SS (and GCE) may help our understanding of the evolution of these genes.
In conclusion, the Met homologous genes isolated from these mosquito species should facilitate studies of the mechanism of methoprene resistance seen in field populations as well as roles for JH in mosquitoes.
Acknowledgments
We thank Dr. Woodbridge A Foster of The Ohio State University for generous help to provide An. gambiae and Dr. Rebecca M Robich for Cx. pipiens in the work. This work was supported by National Institutes of Health grant AI052290 to T.G.W.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Ashok M, Turner C, Wilson TG. Insect juvenile hormone resistance gene homology with the bHLH-PAS family of transcriptional regulators. Proceedings of the National Academy of Sciences, USA. 1998;95:2761–2766. doi: 10.1073/pnas.95.6.2761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Braga IA, Mello CB, Peixoto AA, Valle D. Evaluation of methoprene effect on Aedes aegypti (Diptera: Culicidae) development in laboratory conditions. Memórias do Instituto Oswaldo Cruz. 2005;100:435–440. doi: 10.1590/s0074-02762005000400016. [DOI] [PubMed] [Google Scholar]
- Cornel AJ, Stanich MA, Farley D, Mulligan FS, Byde G. Methoprene tolerance in Aedes nigromaculis in Fresno County, California. Journal of American Mosquito Control Association. 2000;16:223–228. [PubMed] [Google Scholar]
- Cornel AJ, Stanich MA, McAbee RD, Mulligan FS. High level methoprene resistance in the mosquito Ochlerotatus nigromaculis (Ludlow) in Central California. Pest Management science. 2002;58:791–798. doi: 10.1002/ps.521. [DOI] [PubMed] [Google Scholar]
- Dame DA, Wichterman GJ, Hornby JA. Mosquito (Aedes taeniorhynchus) resistance to methoprene in an isolated habitat. Journal of the American Mosquito Control Association. 1998;14:200–203. [PubMed] [Google Scholar]
- Duncan DM, Burgess EA, Duncan I. Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes & Development. 1998;12:1290–1303. doi: 10.1101/gad.12.9.1290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gary RE, Jr, Foster WA. Effect of available sugar on the reproductive fitness and vectorial capacity of the malaria vector Anopheles gambiae (Diptera: Culicidae) Journal of Medical Entomolgy. 2001;38:22–28. doi: 10.1603/0022-2585-38.1.22. [DOI] [PubMed] [Google Scholar]
- Godlewski J, Wang SL, Wilson TG. Interaction of bHLH-PAS proteins involved in juvenile hormone reception in Drosophila. Biochemical and Biophysical Research Communications. 2006;342:1305–1311. doi: 10.1016/j.bbrc.2006.02.097. [DOI] [PubMed] [Google Scholar]
- Hahn ME. The aryl hydrocarbon receptor: A comparative perspective. Comparative Biochemistry and Physiology Part C. 1998;121:23–53. doi: 10.1016/s0742-8413(98)10028-2. [DOI] [PubMed] [Google Scholar]
- Henrick CA, Staal GB, Siddall JB. Alkyl 3, 7, 11-trimethyl-2, 4-dodecadienoates, a new class of potent insect growth regulators with juvenile hormone activity. Journal of Agricultural and Food Chemistry. 1973;21:354–359. doi: 10.1021/jf60187a043. [DOI] [PubMed] [Google Scholar]
- Klowden MJ. Endocrine aspects of mosquito reproduction. Archives of Insect Biochemistry and Physiology. 1997;35:491–512. [Google Scholar]
- Miura K, Oda M, Makita S, Chinzei Y. Characterization of the Drosophila Methoprene-tolerant gene product. FEBS Journal. 2005;272:1169–1178. doi: 10.1111/j.1742-4658.2005.04552.x. [DOI] [PubMed] [Google Scholar]
- Moore AW, Barbel S, Jan LY, Jan YN. A genomewide survey of basic helix-loop-helix factors in Drosophila. Proceedings of National Academy of Sciences, USA. 2000;97:10436–10441. doi: 10.1073/pnas.170301897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mulla MS. The future of insect growth regulators in vector control. Journal of American Mosquito Control Association. 1995;11:269–273. [PubMed] [Google Scholar]
- Nijhout HF, Wheeler DE. Juvenile hormone and the physiological basis of insect polymorphism. Quarterly Review of Biology. 1982;57:109–133. [Google Scholar]
- O’Donnell PP, Klowden MJ. Methoprene affects the rotation of the male terminalia of Aedes aegypti mosquitoes. Journal of American Mosquito Control Association. 1997;13:1–4. [PubMed] [Google Scholar]
- Page RDM. TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences. 1996;12:357–358. doi: 10.1093/bioinformatics/12.4.357. [DOI] [PubMed] [Google Scholar]
- Paskewitz SM, Gorman MJ. Mosquito immunity and malaria parasites. American Entomologist. 1999;45:80–94. [Google Scholar]
- Postlethwait JH. Juvenile hormone and the adult development of Drosophila. Biological Bulletin. 1974;147:119–135. doi: 10.2307/1540573. [DOI] [PubMed] [Google Scholar]
- Qiao CL, Raymond M. The same esterase B1 haplotype is amplified in insecticide resistant mosquitoes of the Culex pipiens complex from the Americas and China. Heredity. 1995;74:339–345. doi: 10.1038/hdy.1995.51. [DOI] [PubMed] [Google Scholar]
- Riddiford LM. Hormone action at the cellular level. In: Kerkut G, Gilbert LI, editors. Comprehensive insect biochemistry, physiology, and pharmacology. Vol. 8. Pergamon; New York: 1985. pp. 37–84. [Google Scholar]
- Riddiford LM. Cellular and molecular actions of juvenile hormone I. General considerations and premetamorphic actions. Advances in Insect Physiology. 1994;24:213–274. [Google Scholar]
- Ritchie SA, Broadsmith G. Efficacy of ALTOSID pellets and granules against Aedes aegypti in ornamental bromeliads. Journal of the American Mosquito Control Association. 1997;13:201–201. [PubMed] [Google Scholar]
- Robich RM, Denlinger DL. Diapause in the mosquito Culex pipiens evokes a metabolic switch from blood feeding to sugar gluttony. Proceedings of National Academy of Sciences, USA. 2005;102:15912–15917. doi: 10.1073/pnas.0507958102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schaefer CH, Miura T, Wilder WH, Mulligan FS., III Evaluation of new chemicals as mosquito control agent. Proceedings and Papers of the California Mosquito and Vector Control Association. 1975;43:75–77. [Google Scholar]
- Staal GB. Insect growth regulators with juvenile hormone activity. Annual Review of Entomology. 1975;20:417–460. doi: 10.1146/annurev.en.20.010175.002221. [DOI] [PubMed] [Google Scholar]
- Swofford DL. PAUP* 4.0: Phylogenetic Analysis Using Parsimony (*and Other Methods) Sinauer Associates; Sunderland, MA.: 2002. [Google Scholar]
- Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research. 1997;24:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rose TR, Schultz ER, Henikoff JG, Pietrokovski S, McCallum CM, Henikoff S. Concensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequence. Nucleic Acids Research. 1998;26:1628–1635. doi: 10.1093/nar/26.7.1628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson TG. The molecular site of action of juvenile hormone and juvenile hormone insecticides during metamorphosis: how these compounds kill insects. Journal of Insect Physiology. 2004;50:111–121. doi: 10.1016/j.jinsphys.2003.12.004. [DOI] [PubMed] [Google Scholar]
- Wilson TG, Fabian J. A Drosophila melanogaster mutant resistant to a chemical analog of juvenile hormone. Developmental Biology. 1986;118:190–201. doi: 10.1016/0012-1606(86)90087-4. [DOI] [PubMed] [Google Scholar]
- Wilson TG, Wang S, Beno M, Farkas R. Wide mutational spectrum of a gene involved in hormone action and insecticide resistance in Drosophila melanogaster. Molecular Genetics and Genomics. 2006 doi: 10.1007/s00438-006-0138-4. in press. [DOI] [PubMed] [Google Scholar]
- Wilson TG, Yerushalmi Y, Donnell DM, Restifo LL. Interaction between hormonal signaling pathways in Drosophila melanogaster as revealed by genetic interaction between Methoprene-tolerant and Broad-Complex. Genetics. 2006;172:253–64. doi: 10.1534/genetics.105.046631. [DOI] [PMC free article] [PubMed] [Google Scholar]
