Table 1.
Twenty polymorphic microsatellite loci in the yeast genome
| Nuclear loci | Primers (forward and reverse) | Locus | Gene and function | Chr. | Repeat | A. A | No. alleles | No. het. |
|---|---|---|---|---|---|---|---|---|
| RMP2 | cccttttaaggaagagcaagcc ccccaataagctgagagtgg | SCPTSY7 | 66 bp 3′ of ribo-nuclease P (RMP2) | XIII | (aat)33 | — | 11 (7/5) | 4 (2/2) |
| 3′ORF1 | ggacagtgggaggagggaaatgg gctttacgcactagattgtgcgg | SC8358 | 37 bases 3′ of ORF similar to a.a. permeases | IV | (tat)24 | — | 5 (4/3) | 0 |
| ORF1 | gcagcgaagctaaacctgttgg caagcattccgaaattgtggg | YBR150c | Potential permease | II | (cat)21 | (D) | 5 (4/2) | 1 (0/1) |
| ORF2 | ggtgactctaacggcagagtgg cccgtatactgcaagtagatcc | YOR267C | Potential permease | XV | (caa)20 | (Q) | 8 (6/3) | 4 (2/2) |
| SSN6 | cagcatcctgctcaacaaacgcc gcagctgttgtcttggtaggggc | YSCSSN6 | SSN6 protein kinase; repressor of transcription | II | (caa)20 | (Q) | 7 (5/5) | 1 (0/1) |
| 3′ORF2 | gctacagcacttgctgaacataagc ccaatcctggatctagttttccc | SCCHRIX | 93 bp 3′ of YIL130W: putative regulatory protein | IX | (taa)19 | — | 5 (2/3) | 1 (0/1) |
| 3′ORF3 | ggcagcgagattgctcttgt cctcccgactgtggcattggcg | SCORFTAN | 51 bp 3′ of J1545; unknown function | X | (taa)16 | — | 6 (4/3) | 3 (0/1) |
| ORF3 | ctgctcaacttgtgatgggttttgg cctcgttactatcgtcttcatcttgc | SC8132X | ORF of unknown function | XVI | (gaa)16 | (E) | 11 (10/4) | 6 (5/1) |
| FAB1 | ctacaattccaaaggtccttcgc cgtgccattgtcgtttgaggg | U01017 | FAB1 kinase; essential for vacuole function | VI | (aat)15 | (N) | 6 (6/3) | 2 (2/2) |
| SIS2 | gtaaatatgctgcgtgaatttgcc caaaatcgttatgaaattgggtggg | SCYKR072C | SIS2; aspartic acid-rich protein | XI | (gac)13 | (D) | 6 (6/5) | 5 (2/3) |
| ORF4 | gctcgcagggagaaatctgcttcc cttcatcggtatccgttccactagg | SC8337 | Unknown function | XIII | (gat)11 | (D) | 4 (4/2) | 0 |
| SRP40 | gaaaattaaagttgacgaagtgcc gatccactggagctagagtcgg | YSCSRP40X | SRP40; RNA polymerase I & III supressor | XI | (agc)11 | (S) | 4 (4/3) | 3 (3/0) |
| NAB3 | cgatggaatcgaatttgacgcccc cctcatcctcaccgtcttcagcggc | SCU05314 | NAB3; polyadenylated RNA-binding gene | XVI | (gaa)10 | (E) | 5 (5/3) | 2 (1/1) |
| CCP | ctgggcagaaccgcccataagagg gacctccctttttcgacagaggcg | YSCCCP | CCP; cytochrome c peroxidase precursor | XI | (gct)9 | (A) | 6 (5/2) | 3 (3/0) |
| TFA1 | gaatgattactacgctgctttggc cggaccatatcaaacgtcctc | SCU12825 | TFAI; TFIIE large subunit | XI | (tta)10 | (N) | 6 (5/3) | 2 (1/1) |
| FUN12 | cgcaagaatccaccgcaagcc gtcttaccggtatcgacatgaccc | YSCFUN12A | FUN12; essential gene | I | (gaa)9 | (E) | 5 (4/2) | 2 (1/1) |
| NGR1 | ccaataagattatcatggggacgcc gcaccgtcttgttcgatatacggg | SCNGR1 | NGR1; negative growth regulatory gene | II | (cag)9 | (Q) | 3 (3/2) | 0 |
| SNF5 | gcaacgacaccaacagttactgagg cgctggagctaagggcacttgacc | YSCSNF5 | SNF5; transcriptional activator | II | (caa)9 | (Q) | 3 (3/2) | 3 (1/2) |
| GRR | gctgcacccacctgatatacatcc cgttgcatccctaacctcacttgc | YSCGRR1 | GRR; required for glucose repression | X | (cag)9 | (Q) | 3 (3/1) | 1 (1/0) |
| 3′ORF4 | gcaacccatgcttggttcaactcc gctttaaccattaagctaagagagc | YSCMTCG03 | intergenic region of trna-lys and trna-arg | MT | (taa)10 | — | 4 | Haploid |
A total of 12 yeast strains were genotyped, seven S. cerevisiae and five strains of closely related species. All loci examined, without exception, were found to be length-polymorphic, with 3-11 alleles. Both intra- and interspecific variation was found. If the numbers of alleles and heterozygotes found in the seven strains of S. cerevisiae and the five additional Saccharomyces species differ, they are given in parentheses. Primer sites were conserved across all strains and species except for the loci NAB3, NGR1, and GRR, which failed to amplify in Zygosaccharomyces, the most distantly related yeast strain. MT, mitochondrial.