TABLE 1.

Activities of the 3′ CSI PPMO against mosquito-borne flaviviruses^a

Virus	Targeted sequenceb	Viral titer (PFU/ml) after treatment with:		3′ CSI PPMO-mediated reduction (n-fold)c	Viral titer (PFU/ml) after treatment with scramble PPMO	Scramble PPMO-mediated reduction (n-fold)c
		No PPMO	3′ CSI PPMO
WNV	AACAGCATATTGACACCTGGGA	5.8 × 108	5.9 × 103	98,300	4.1 × 108	1.4
JEV	AACAGCATATTGACACCTGGGA	2.8 × 107	1.4 × 103	20,000	2.0 × 107	1.4
SLEV	AACAGCATATTGACACCTGGGA	5.5 × 106	4.5 × 103	1,200	4.2 × 106	1.3
DENV-2	AACAGCATATTGAC-GCTGGGA	6.1 × 106	6.0 × 105	10	1.9 × 107	0.3
YFV	GGGACCATATTGACGCCAGGGA	1.7 × 107	6.1 × 106	3	4.6 × 106	3.7

^aVero cells were infected with the indicated virus (MOI of 0.1), treated with a redesigned 3′ CSI PPMO (7.5 μM), and assayed for viral titers at 40 to 42 h postinfection.

^bSequences from various mosquito-borne flaviviruses targeted by the 3′ CSI PPMO. Nucleotide changes relative to the WNV sequence are underlined, and a nucleotide deletion is indicated by a hyphen. Sequences were derived from GenBank entries with accession numbers AF404756, NC_001437, CQ897117, U87411, and U17066 for WNV, JEV, SLEV, DENV-2, and YFV viruses, respectively.

^cThe reduction (n-fold) in viral titer was calculated as follows: viral titer without PPMO treatment/viral titer with PPMO treatment.