Table 1.
List of Drosophila miRNAs and additional unverified candidates supported by third-species conservation
| Reference set miRNAs | ||||||||||
| Rank | Score | miR name | miR position | Cytological position | Sequence | Ano | Apis | Other | Nearest gene | Comment |
| 2 | 26.15 | miR-2a-2 (1) | 2L:19547562 | 37E | UAUCACAGCCAAGCUUUGAUGAGC | - | - | In the intron of spi (sense) | [10]; 3 miR cluster | |
| 3 | 26.00 | miR-2a-1 (2) | 2L:19547974 | 37E | UAUCACAGCCAGCUUUGAUGAGC | + | + | Worm | In the intron of spi (sense) | [10]; 3 miR cluster |
| 6 | 24.16 | miR-2b-2 (3) | 2L:19548259 | 37E | UAUCACAGCCAGCUUUGAGGAGC | + | + | In the intron of spi (sense) | [10]; 3 miR cluster | |
| (8) | 24.01* | miR-2b-1 | 2L:8250840 | 28B | UAUCACAGCCAGCUUUGAGGAGC | - | - | 895 upstream of Btk29A | [10]; failed conservation filter | |
| 8 | 23.52 | miR-13b-2 (4) | X:8830202 | 8C | UAUCACAGCCAUUUUGACGAGU | - | - | In the intron of CG7033 (sense) | [10] | |
| 9 | 23.45 | miR6-3 (5) | 2R:14724424 | 56E | UAUCACAGUGGCUGUUCUUUUU | - | - | 1732 upstream of CG11018 | [10]; 7 miR cluster | |
| 12 | 22.89 | miR-12 (6) | X:15240478 | 13D | UGAGUAUUACAUCAGGUACUGGU | + | + | 1986 upstream of Ac13E | [10]; 2 miR cluster | |
| 13 | 22.84 | miR-7 (7) | 2R:15669777 | 57A | UGGAAGACUAGUGAUUUUGUUGU | + | + | Vertebrate | 816 upstream of CG30147 | [10] |
| 17 | 22.45 | miR-14 (8) | 2R:4614375 | 45E | UCAGUCUUUUUCUCUCUCCUA | + | + | 5855 upstream of Or45b | [10] | |
| 27 | 20.94 | miR-9 (9) | 3L:19515075 | 76C | UCUUUGGUUAUCUAGCUGUAUGA | + | + | 6462 upstream of Shal | [10] | |
| 29 | 20.77 | miR6-2 (10) | 2R:14724582 | 56E | UAUCACAGUGGCUGUUCUUUUU | - | - | 1574 upstream of CG11018 | [10]; 7 miR cluster | |
| 31 | 20.65 | miR6-1 (11) | 2R:14724711 | 56E | UAUCACAGUGGCUGUUCUUUUU | - | - | 1445 upstream of CG11018 | [10]; 7 miR cluster | |
| 33 | 20.38 | miR-13a (12) | 3R:11243269 | 88F | UAUCACAGCCAUUUUGAUGAGU | + | + | 4626 upstream of CG6118 | [10]; 3 miR cluster | |
| 36 | 20.08 | miR-5 (13) | 2R:14724858 | 56E | AAAGGAACGAUCGUUGUGAUAUG | - | - | 1298 upstream of CG11018 | [10]; 7 miR cluster | |
| 62 | 18.86 | let-7 (14) | 2L:18450101 | 36E | UGAGGUAGUAGGUUGUAUAGU | + | + | Vertebrate/ worm | 932 upstream of CG10283 | [9]; 3 miR cluster |
| 18.45* | miR-10 | 3R:2635277 | 84B | ACCCUGUAGAUCCGAAUUUGU | + | + | Vertebrate | 13566 upstream of Scr | [10]; (not on aligned contig) | |
| 74 | 18.42 | miR-1 (15) | 2L:20457182 | 38D | UGGAAUGUAAAGAAGUAUGGAG | + | - | Vertebrate/ worm | 14444 upstream of CG15476 | [10] |
| 96 | 17.79 | miR-3 (16) | 2R:14725313 | 56E | UCACUGGGCAAAGUGUGUCUCA | - | - | 843 upstream of CG11018 | [10]; 7 miR cluster | |
| 114 | 17.49 | miR-11 (17) | 3R:17439181 | 93E | CAUCACAGUCUGAGUUCUUGC | - | - | In the intron of E2f (sense) | [10] | |
| 124 | 17.36 | miR-4 (18) | 2R:14724998 | 56E | AUAAAGCUAGACAACCAUUGA | - | - | 1158 upstream of CG11018 | [10]; 7 miR cluster | |
| 172 | 16.54 | miR-13b-1 (19) | 3R:11243135 | 88F | UAUCACAGCCAUUUUGACGAGU | + | + | 4760 upstream of CG6118 | [10]; 3 miR cluster | |
| 192 | 16.27 | miR-8 (20) | 2R:11895154 | 53D | UAAUACUGUCAGGUAAAGAUGUC | + | + | 3783 downstream of CG6301 | [10] | |
| 14.20 | miR-125 | 2L:18450405 | 36E | UCCCUGAGACCCUAACUUGUGA | + | + | Vertebrate/ worm | 628 upstream of CG10283 | [29]: low score; 3 miR cluster | |
| miR-2c | 3R:11243493 | 88F | UAUCACAGCCAGCUUUGAUGGGC | - | - | 4402 upstream of CG6118 | Hom; score n/a; 3 miR cluster | |||
| Newly verified miRNAs | ||||||||||
| Rank | Score | miR name | miR position | Cytological position | Sequence | Anos | Apis | Other | Nearest gene | Comment |
| 4 | 24.67 | miR-184 | 2R:8394117 | 50A | UGGACGGAGAACUGAUAAGGG | + | + | Vertebrate | 24406 upstream of CG17048 | Expression verified |
| 7 | 24.15 | miR-274 | 3L:11614451 | 68C | UUUUGUGACCGACACUAACGGGUAAU | - | - | In the intron of CG32085 (antisense) | Expression verified | |
| 10 | 23.10 | miR-275 | 2L:7418027 | 27F | cAGUCAGGUACCUGAAGUAGCGCGCG | + | + | 1070 upstream of CG5261 | 2miR cluster (+Ano and Apis); expression verified | |
| 16 | 22.57 | miR-92a | 3R:21461594 | 96E | CAUUGCACUUGUCCCGGCCUG | + | + | Vertebrate | 6578 upstream of BcDNA:LD22548 | 2miR cluster |
| 21 | 21.72 | miR-219 | 3L:17263886 | 74A | UGAUUGUCCAAACGCAAUUCUUG | + | + | Vertebrate | 4955 upstream of CG6485 | Expression not seen |
| 25 | 21.12 | miR-276a | 3L:10322758 | 67E | CAGCGAGGUAUAGAGUUCCUACG | + | + | 47587 upstream of CG12362 | Duplicated, 45 kb apart; expression verified; 1copy in Ano and Apis | |
| 28 | 20.88 | miR-277 | 3R:5925763 | 85F | UGUAAAUGCACUAUCUGGUACGACAU | + | + | 1391 upstream of Fmr1 | 2 miR cluster; expression verified | |
| 30 | 20.73 | miR-278 | 2R:10720792 | 52B | ggUGGGACUUUCGUCCGUUUGUAA | + | - | 386 upstream of fus | Expression verified | |
| 34 | 20.27 | miR-133 | 2L:20586360 | 38D | UUGGUCCCCUUCAACCAGCUGU | + | + | Vertebrate | 1059 downstream of CG15475 | 3 miR cluster; expression verified; [45] |
| 37 | 20.03 | miR-279 | 3R:25030674 | 99A | UGUGACUAGAUCCACACUCAU | + | + | 1328 upstream of CG31044 | Related to miR-286; expression verified | |
| 38 | 19.90 | miR-33 | 3L:19716503 | 76C | AGGUGCAUUGUAGUCGCAUUG | - | - | Vertebrate | In the intron of HLH106 (sense) | |
| 39 | 19.77 | miR-280 | 2R:3358854 | 44C | UGUAUUUACGUUGCAUAUGAAAUGAUA | - | - | 21740 upstream of CG30358 | Expression verified | |
| 41 | 19.73 | miR-281a | 2R:7235078 | 48E | ACUGUCGACGGACAGCUCUCUU | - | - | 356 downstream of SmD3 | Duplicated cluster; expression verified; 1 copy in Ano | |
| 43 | 19.64 | miR-282 | 3L:3231652 | 63C | aaucUAGCCUCUACUAGGCUUUGUCUGU | + | - | 7132 upstream of CG14959 | Expression verified | |
| 44 | 19.55 | miR-283 | X:15238971 | 13D | AAAUAUCAGCUGGUAAUUCUGGG | + | + | 3493 upstream of Ac13E | 2 miR cluster; expression verified | |
| 46 | 19.52 | miR-284 | 3R:8377257 | 87C | UGAAGUCAGCAACUUGAUUCCAGCAAUUG | - | - | 1128 upstream of CG6989 | Expression verified | |
| 47 | 19.47 | miR-281b | 2R:7234866 | 48E | ACUGUCGACGGAUAGCUCUCUU | + | - | 144 downstream of SmD3 | Duplicated cluster; expression verified | |
| 49 | 19.35 | miR-34 | 3R:5926677 | 85F | UGGCAGUGUGGUUAGCUGGUUG | + | + | Vertebrate/ worm | 477 upstream of Fmr1 | 2 miR cluster; expression verified; [45] |
| 50 | 19.27 | miR-263a | 2L:11942273 | 33B | aAUGGCACUGGAAGAAUUCACg | + | + | Vertebrate | 4764 downstream of CG16964 | Expression verified; [34] |
| 59 | 18.89 | miR-124 | 2L:17544454 | 36D | AUAAGGCACGCGGUGAAUGCCA | + | + | Vertebrate/ worm | 10606 downstream of CG7094 | 2 miR cluster; [45] |
| 66 | 18.58 | miR-79 | 2L:16676639 | 36A | AUAAAGCUAGAUUACCAAAGC | + | + | Worm | 822 upstream of CG31782 | 3 miR cluster; expression verified; [45] |
| 67 | 18.57 | miR-276b | 3L:10277315 | 67E | CAGCGAGGUAUAGAGUUCCUACG | - | - | Vertebrate | 7073 downstream of CG6559 | Duplicated, 45 kb apart; expression verified; 1copy in Ano and Apis |
| 77 | 18.36 | miR-210 | X:17859179 | 16F | UUGUGCGUGUGACAGCGGCUA | + | + | Vertebrate | 1193 downstream of CG32553 | |
| 83 | 18.11 | miR-285 | 3L:11903642 | 68E | UAGCACCAUUCGAAAUCAGUGCU | - | - | Vertebrate | 1592 upstream of CG7252 | Similar to miR-29 |
| 18.08* | miR-100 | 2L:18449518 | 36E | AACCCGUAAAUCCGAACUUGUG | + | - | Vertebrate | 1515 upstream of CG10283 | Failed conservation filter; 3 miR cluster; expression verified; [45] | |
| 91 | 17.93 | miR-92b | 3R:21466486 | 96E | AAUUGCACUAGUCCCGGCCU | + | - | Vertebrate | 1686 upstream of BcDNA:LD22548 | Expression verified; 2 miR cluster; [45] |
| 145 | 17.12 | miR-286 | 2R:14724858 | 56E | AGUGACUAGACCGAACACUCG | + | - | 1013 upstream of CG11018 | Expression verified; 7 miR cluster; related to miR-279 | |
| 146 | 17.11 | bantam | 3L:622845 | 61C | AGUGAGAUCAUUUUGAAAGCUG | + | - | Worm | 6301 upstream of CG12030 | [44] |
| 208 | 16.09 | miR-289 | 3L:13578391 | 70C | UAAAUAUUUAAGUGGAGCCUGCGACU | - | - | In the intron of bru-3 (antisense) | Expression verified | |
| 13.73 | miR-287 | 2L:17552694 | 36D | UGUGUUGAAAAUCGUUUGCAC | + | - | 14896 upstream of Oli | Very low score;found by proximity to miR-124; expression verified | ||
| 13.35 | miR-87 | 2L:9942828 | 30D | UGAGCAAAAUUUCAGGUGUG | - | - | Worm | 2009 upstream of CG13126 | Hom: very low score | |
| miR-263b | 3L:15666960 | 72D | cuUGGCACUGGGAGAAUUCACa | + | - | Vertebrate | 4243 upstream of comm | Hom; score n/a | ||
| miR-288 | 2L:20588106 | 38D | UUUCAUGUCGAUUUCAUUUCAUG | + | - | 2805 downstream of CG15475 | Score n/a; found by proximity to miR-133; expression verified | |||
| Unverified Ano-conserved candidates | ||||||||||
| Rank | Score | miR name | miR position | Cytological position | Sequence | Ano | Apis | Other | Nearest gene | Comment |
| 1 | 26.76 | 2R:4681879 | 46A | CAUCACACCCAGGUUGAGUGAGU | + | + | In the intron of Mmp2 (antisense) | NT | ||
| 5 | 24.35 | 3R:121090 | 82A | AAAUUGACUCUAGUAGGGAGUCC | + | + | 533 downstream of CG9780 | NT | ||
| 14 | 22.63 | X:1545630 | 2B | UGCAGGUUUCGUCGACAACGA | + | - | 732 upstream of CG32806 | NT | ||
| 19 | 22.13 | 3L:21585985 | 79A | CGAUUUGUCUUUUUCCGCUUACUG | + | - | 1727 downstream of CG7160 | NT | ||
| 20 | 21.95 | 3L:18809845 | 75E | UUUUGAUUGUUGCUCAGAAAGCC | + | + | 3283 upstream of CG6865 | No expression seen either strand | ||
| 23 | 21.38 | 3L:8530512 | 66D | GUGAGAUAUGUUUGAUAUUCUUGGUUGUU | + | + | 2374 upstream of CG6638 | NT | ||
| 40 | 19.75 | X:12366993 | 11B | UAUCAUAAGACACACGCGGCUAU | + | - | in the intron of tomosyn (sense) | NT | ||
| 54 | 19.06 | 2R:11128979 | 52E | guUAUUGCUUGAGAAUACACGUAGUU | + | + | 15915 upstream of Dg | No expression seen either strand | ||
| 61 | 18.86 | 2L:859210 | 21D | AGUUUGUUCGUUUGGCUCGAGUUAU | + | - | 2208 downstream of CG13949 | NT | ||
| 104 | 17.64 | 2L:16676008 | 36A | UCUUUGGUAUUCUAGCUGUAGA | + | - | 1453 upstream of CG31782 | No expression seen; miR-79 cluster | ||
| 117 | 17.44 | 3R:21403955 | 96E | UGAUAUUGUCCUGUCACAGCAGUA | + | - | 3265 upstream of CG12250 | No expression seen | ||
| 123 | 17.36 | 2L:7418192 | 27F | AUUGUACUUCAUCAGGUGCUCUGGUG | + | + | 905 upstream of CG5261 | NT | ||
| 126 | 17.31 | 3R:16621175 | 92F | UUUGUUUUGCAAUUUUCGCUUU | + | - | In the intron of CG17838 (sense) | NT | ||
| 130 | 17.24 | 2L:16676828 | 36A | CUUUGGUGAUUUUAGCUGUAUG | + | - | 633 upstream of CG31782 | No expression seen; miR-79 cluster | ||
| 183 | 16.39 | 2R:7223583 | 48E | UCAUCCCCUUGUUGCAAACCUCACGC | + | - | In the intron of CG8877 (sense) | NT | ||
| 190 | 16.28 | 3R:5916861 | 85F | UGGGAUACACCCUGUGCUCGCU | + | - | 17107 upstream of CG5361 | NT | ||
| 195 | 16.24 | 2L:243049 | 21B | CAUAAGCGUAUAGCUUUUCCC | + | + | In the intron of kis (sense) | NT | ||
These sequences were identified as high-scoring candidates through miRseeker analysis of drosophilid genomes (except as noted) and are ordered by their rank and score. The first part of the table includes members of the reference set, whose rank within the reference set is given in parentheses after the gene name; thus miR-4 ranked 18th among the reference set and 124th overall. The second part of the table includes miRNAs newly identified in this study. In general, we defined a candidate miRNA sequence on the basis of the bounds of conserved sequence; this is often longer than the presumed 21-22 nucleotide mature product. The third part of the table includes unverified gene predictions supported by conservation in Anopheles and/or Apis. Drosophila-specific predictions without confirming expression data may be viewed on the web [43]. References in the comments are to miRNAs that have been independently identified in previous or concurrent studies. n/a, score not available; NT, expression not tested; Hom, miRNA identified solely by homology to other miRNAs. The following miRs were not identifed by miRseeker: miR-10 was not aligned using the first release of the D. pseudoobscura genome while miR-2b-1 and miR-100 failed the conservation filters. These three received very high miRseeker scores, however, and they have been placed into the list for the sake of comparison, although they are not ranked. Six additional miRNAs scored poorly but are genuine. These include two members of the reference set (miR-125 and miR-2c), two that were identified by homology to miRNAs cloned from other species (miR-87 and miR-263b), and two that were identified as Anopheles-conserved stem-loops located in proximity to other Drosophila miRNAs whose expression was verified by northern analysis (miR-287 and miR-288). Most miRNAs are located in intragenic regions, and there is an apparent bias for intronic miRNAs to be located on the transcribed strand.