TABLE 1.
Target genes and primers used for PCR analysis of excised valves
| Gene (reference) | Primer (5′-3′ sequence)a | Location of primer (S. pneumoniae TIGR4 genome) | Fragment size (bp) |
|---|---|---|---|
| 16S rRNA (24) | fD1 (AGAGTTTGATCCTGGCTCAG) | 1975719-1975700 | 1,496 |
| rP2 (ACGGCTACCTTGTTACGACTT) | 1974211-1974231 | ||
| 1913703-1913684 | 1,496 | ||
| 1912195-1912215 | |||
| 15355-15374 | 1,496 | ||
| 16863-16843 | |||
| rpoBb | StrpF-Ecoq (TGiArTTTrTCATCAACCATGTG) | 4279-4296 | 590 |
| StrpR-Ecoq (AARYTiGGMCCTGAAGAAAT) | 5013-4994 | ||
| gki gene (7) | gki-up (GGCATTGGAATGGGATCACC) | 9497-9516 | 698 |
| gki-dn (TCTCCCGCAGCTGACAC) | 10122-10106 |
a
i, inositine; r, A or G; Y, C or T; M, A or C.
b
Primers were chosen after comparison of sequences from Staphylococcus aureus, Listeria monocytogenes, Enterococcus faecalis, and Streptococcus pyogenes.