Skip to main content
. 2007 Jul 13;104(30):12306–12311. doi: 10.1073/pnas.0701244104

Fig. 2.

Fig. 2.

Nab2 binds preferentially to polyadenosine RNA. Nucleic acid binding properties of Nab2 were investigated by competition experiments. Nab2 was incubated in binding buffer with Cy3-poly(A)25 RNA and increasing amounts (up to 5 μM) of an unlabeled 25-nt competitor oligonucleotide. (A) Poly(A) RNA. (B) Random sequence ssDNA (CTTCTCTAGTTCAATCTTAGCATCG). (C) Poly(A) DNA. (D) Poly(N) RNA (a pool of random 25-nt RNA oligonucleotides). Unlabeled poly(A)25 RNA competes for binding to Nab2. Both DNA oligonucleotides showed very limited competition. No competition was observed when using poly(N)25 RNA oligonucleotide. (E) GST-Nab2 (50 nM) was incubated with a radioactively labeled poly(A)25 RNA oligonucleotide probe (≈30 pM), and increasing amounts of unlabeled poly(A)25, poly(G)25, or poly(AG)12 RNA competitor were added as indicated. RNA–protein complexes were then resolved from free probe by electrophoresis on a 5% nondenaturing polyacrylamide gel. No significant competition for Nab2 binding was observed upon addition of either poly(G)25 or poly(AG)12 RNA competitor oligonucleotide.