TABLE 2.
Primers used in this study
| Region | Primer | Orientation | Sequence (5′-3′)a | Positionb | Reference |
|---|---|---|---|---|---|
| 5′ UTR | NC1 | Sense | CTCCGGCCCCTGAATGCG | 445-462 | 41 |
| E2 | Antisense | ATTGTCACCATAAGCAGCCA | 596-577 | 41 | |
| VP1 | 292 | Sense | MIGCIGYIGARACNGG | 2613-2628 | 31 |
| 222 | Antisense | CICCIGGIGGIAYRWACAT | 2969-2951 | 31 | |
| VP2 | AM11 | Sense | GARGCITGYGGITAYAGYGA | 962-981 | This study |
| AM12 | Sense | GARGARTGYGGITAYAGYGA | 962-981 | This study | |
| AM21 | Sense | GGITGGTGGTGGAARYTICC | 1178-1197 | This study | |
| AM22 | Sense | GGITGGTAYTGGAARTTICC | 1178-1197 | This study | |
| AM31 | Antisense | TTDATDATYTGRTGIGG | 1545-1529 | This study | |
| AM32 | Antisense | TTDATCCAYTGRTGIGG | 1545-1529 | This study |
a
The following standard ambiguity codes were used: D = G, A, or T; R = A or G; Y = T or C; N = A, T, C, or G; M = A or C; and I = deoxyinosine.
b
With reference to the sequence of PV-1.