TABLE 1.
Strains, plasmids, and primers used in this study
| Strain or plasmid | Relevant characteristics or sequencea | Source or reference |
|---|---|---|
| Strains | ||
| E. coli | ||
| TG1 | E. coli general cloning host | 16 |
| EC1000 | E. coli cloning host for repA-dependent plasmids; carries constitutive repA allele on chromosome; Kanr | 8 |
| E. faecalis | ||
| OG1RF | E. faecalis Fusr Rifr; p-Cl-Pher | 11 |
| CK111/pCF10-101 | E. faecalis conjugative donor strain; carries constitutive repA allele on chromosome and nontransferable pCF10 derivative; Spcr Tetr | 7 |
| DAGF27 | Tn917 transposon insertion at +581 bp from the ebpRa ATG in OG1RF; Ermr Fusr Rifr | 5 |
| TX5475 | ebpA allelic replacement aph(3′)-IIIa mutant of OG1RF; Fusr Kanr Rifr | 13 |
| TX5460 | ebpB insertion disruption mutant of OG1RF; Fusr Kanr Rifr | 13 |
| TX5448 | ebpC insertion disruption mutant of OG1RF; Fusr Kanr Rifr | 13 |
| TX5514 | ebpR in-frame deletion from bp −5 to +1337 from the ATG of ebpR of OG1RF; Fusr Rifr; p-Cl-Pher | This study |
| TX5584 | TX5514(pMSP3535); Ermr Fusr Rifr; p-Cl-Pher | This study |
| TX5582 | TX5514(pTEX5515); ebpR mutant containing ebpR gene inserted into pMSP3535; Ermr Fusr Rifr; p-Cl-Pher | This study |
| TX5590 | OG1RF(pTEX5586); OG1RF containing the ebpR promoter fused to lacZ; Ermr Fosr Rifr | This study |
| TX5591 | TX5514(pTEX5586); ebpR mutant containing the ebpR promoter fused to lacZ; Ermr | This study |
| Plasmids | ||
| pMSP3535 | Nisin-inducible expression shuttle vector with pAMβ1 and ColE1 replicons; Ermr | 3 |
| pTCV-lacZ | Shuttle vector containing promoterless lacZ; Ermr | 14 |
| pTEX5515 | pMSP3535 with ebpR from bp −20 to +1561 from the ATG; this ebpR fragment contains the full ORF and the RBS of ebpR; Ermr | This study |
| pTEX5586 | pTCV-lacZ containing 301 bp from bp 248 upstream to bp 53 downstream of the start codon of ebpR; Ermr | This study |
| pTEX5269 | pTCV-lacZ containing 103 bp from bp −110 to −8 of the start codon of fsrB; Ermr | 26 |
| Primers | ||
| ebpR deletion | Upstream fragment was amplified using GCTCTAGACAGGACCCACACTTTTCA with CGGGATCCTTTCCTCCCAAGTCCTTT, and the downstream fragment was amplified using CGGGATCCTTGAAACCAGTGTTCCAAG with GGAATTCTGGTCAGCAAACGATTTT | |
| ebpR complementation | The primers CCGAGCTCGGACTTGGGAGGAAACAATA and CGGGATCCAAGTCATTTCGACTTATGTCCT were used to amplify ebpR from 20 bp upstream of the start codon to 138 bp downstream of the stop codon | |
| ebpR promoter fusion | The primers GGAATTCAAGACTACGCCGAAAACC and CGGGATCCACACGAATGATTTCTTCCA were used to amplify from 248 bp upstream to 53 bp downstream of the start codon of ebpR. | |
| Quantitative RT-PCR primers | gyrB, ACCAACACCGTGCAAGCC and CAAGCCAAAACAGGTCGCC; ebpA, AAAAATGATTCGGCTCCAGAA and TGCCAGATTCGCTCTCAAAG; srtC, ACACATGCGGTCATTTCAGG and GCGTCTTCCCATTGACTTCG |
a
ORF, open reading frame; RBS, ribosome binding site. ebpR = ef1090. Kanr, kanamycin resistance; Fusr, fusidic acid resistance; Rifr, rifampin resistance; p-cl-Pher, p-chloro-phenylalanine resistance; Spcr, spectinomycin resistance; Tetr, tetracycline resistance; Ermr, erythromycin resistance. Restriction enzyme recognition sites are underlined.