TABLE 1.
Strains, plasmids, and oligonucleotide primers
| Strain, plasmid, or primer | Relevant genotype, description or sequence (5′ to 3′)a | Source or reference |
|---|---|---|
| Strains | ||
| E. coli | ||
| DH5α | recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 ΔlacU169(φ80lacZΔM15) | Gibcoe |
| TOP10F′ | F′ [lacIq Tn10(Tetr)] mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 | Invitrogene |
| recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (Strr) endA1 nupG | ||
| SM10 | Kmr; mobilizer strain | 29 |
| P. aeruginosa | ||
| PAO1 | Wild type | C. Manoil |
| JVC | PAO1 with narK1-Plac | This study |
| Plasmids | ||
| pUCP18 | Apr; broad-host-range cloning vector | 26 |
| pUCGMlox | Gmr; Gmr cassette flanked by lox sequences | 20 |
| pUCGMxlac | Gmr; PLAC promoter ligated within the ClaI and SacII sites of pUCGMlox | This study |
| pGem-lacIq | Apr; 1-kb PCR fragment containing lacIq from TOP10F′ in pGEM-T Easy vector (Promega) | This study |
| pREP | Apr; ligation of a blunt-ended 1-kb EcoRI fragment containing lacIq from pGem-lacIq into the blunt-ended EcoRI and SapI sites of pUCP18 | This study |
| pFLP2 | Apr; Flp vector containing sacB and flp (Flp recombinase) | 12 |
| pCM157 | Tcr; source of cre recombinase | 15 |
| pCR2.1-cre | Apr; Kmr; 1.3-kb PCR fragment containing cre recombinase in pCR2.1 (Invitrogen) | This study |
| pCRE | Apr; 1.3-kb EcoRI fragment of pCR2.1-cre ligated into an EcoRI digest of pFLP2 | This study |
| pEX18Ap::narK1K2 | Apr; 2.7-kb EcoRI fragment containing narK1 and narK2 ligated into the EcoRI site of pEX18Ap | 27 |
| pEXJVC | Apr; Gmr; 1.5-kb SmaI fragment from pUCGMxlac blunt ended into the NotI site of pEX18Ap::narK1K2 | This study |
| Primer/templateb | ||
| Plac/Pucp18 (+) | TGTATCGATTCGCCACCTCTGACTT | This study |
| Plac/Pucp18 (−) | CTCCGCGGCGTAATCATGGTCATAG | This study |
| lacIq/Top 10F′ DNA (+) | GTGCAAAGCTCTTCGCGGTAT | This study |
| lacIq/Top 10F′ DNA (−) | CGCGAATTCACATTAATTGCGTTG | This study |
| cre/pCM157 (+) | GAATTCGCAAACCGCCTCTC | This study |
| cre/pCM157 (−) | CCAGTGAATTCTTACTAATCGCCATC | This study |
| narK1K2 (+)c | CCTGTCACTACCTCCAAAG | 27 |
| narK1K2 (−)c | AGAAGCTGATATTGGACATG | 27 |
| narG (+)d | ACGACCTCAACACCTCCGAC | This study |
| narG (−)d | GATCTCCCAGTCGCTCTTGG | This study |
| rpoD (+)d | GGGCGAAGAAGGAAATGGTC | 23 |
| rpoD (−)d | CAGGTGGCGTAGGTGGAGAA | 23 |
a
Kmr, Apr, Gmr, and Tcr indicate resistance to kanamycin, ampicillin, gentamicin, and tetracycline, respectively. Underlined nucleotides were modified to accommodate a restriction site.
b
Template DNA used with the corresponding primer is indicated; plus and minus symbols indicate forward and reverse primers, respectively.
c
Used for mutant confirmation.
d
Used for real-time PCR.
e
Located in Carlsbad, CA.