TABLE 1.
Bacterial strains, plasmids, vectors and primers used
| Strain, plasmid, or primer | Genotype, comment(s), and/or source or referencea |
|---|---|
| Strain | |
| D. vulgaris subsp. vulgaris strain Hildenborough | NCIMB 8303; isolated from clay soil near Hildenborough, United Kingdom (22) |
| D. vulgaris Hyd100 | Δhyd; Sucr Cmr (21) |
| D. vulgaris NiFe100 | Δhyn1; Sucr Cmr (11) |
| D. vulgaris Hys100 | Δhys; Sucr Cmr (this study) |
| D. vulgaris HydHyn1 | Δhyd Δhyn1; Sucr Cmr Kmr (this study) |
| E. coli S17-1 | thi pro hsdR hsdM+recA RP4-2 (Tc::Mu, Km::Tn7) (26) |
| Plasmid | |
| pUC19Cm | pUC19 containing the Cm gene (10) |
| pNOT19 | Cloning vector pUC19; NdeI site replaced by a NotI site (25) |
| pMOB2 | Contains oriT of plasmid RP4 and Bacillus subtilis sacBR genes on a 4.5-kb NotI fragment; Kmr Cmr (25) |
| pBSL180 | Source of nptII gene (1) |
| pNOT180 | 1.3-kb SacI fragment containing nptII cloned in pNOT19 (this study) |
| pNOTΔNiFeCm | 11 |
| pNOTΔNiFeKm, pNOTΔNiFeKmMob | This study |
| pNOTΔhys, pNOTΔhysCm, pNOTΔhysCmMob | This study |
| Primer | |
| p225f | 5′tcgaaagcttCGGCGCGGTAACACGATT (+3259 to +3276) |
| p228r | 5′agtacggatccCATCGTGTGGTTGGCGAC (+4007 to +3991) |
| p293r | 5′TGATGTAATCGCCAAGGGCCG (+7297 to +7277) |
| p292f | 5′GGCGATACTCGCTTCGTT (+3237 to +3254) |
| p354f | 5′-tcgaggatccTGCTGCCGACGCCCATGATGT (+2593 to +2613) |
| p355r | 5′-tcgagagctcTGCCACCCAGCATCTCTGCCA (+3112 to +3092) |
| p356r | 5′-CATGCCTAGCACATGCATGGT (+3141 to +3121) |
| p300f | 5′-tcgaaagcttGGGCATGACAGATTGACCAC (−535 to −516) |
| p302r | 5′-tcgaggatccAGTGCCAGCCAATAGAGTGAA (−27 to −47) |
| p304f | 5′-GGCGTGTCCTACAACATCATC (−624 to −604) |
a
For the primers, the positions given are relative to the start of the hysB coding region (bp +1 to +953); hysA is located from +987 to +2519, hynB1 is located from +3576 to +4581, and hynA1 is located from +4581 to +6281. Lowercase letters are bases added to create restriction endonuclease cleavage sites.