Table 2.

Comparison of the nuclear genomes of Cyanidioschyzon, Ostreococcus (an ultra-small green alga), Arabidopsis (a flowering plant) and Ashbya (a filamentous fungal pathogen).

Organism	No. of protein-coding genes	Genes with introns (%)	No. of rRNA gene units	No. of chromosomes with histone genes	Transposable elements in genome (%)	Telomere repeat sequences
Arabidopsis	26207	79	~800	5≤	~15	TTTAGGG
Ostreococcus	8166	39	4	6≤	~10	TTTAGGG
Cyanidioschyzon	4775	0.5	3	1	0.7	AATGGGGGG
Ashbya	4718	5	~50	4≤	0.1>	CGCTGAGAGACCCATACACCACAC

Bold type indicates the smallest number in non-symbiotic eukaryotes.

Two non-symbiotic eukaryotes, Schizosaccharomyces pombe and the filamentous fungus Ashbya gossypii, have nuclear protein-coding genes that are as small in number as those of C. merolae.

The number of protein-coding genes in the nuclear genome of S. pombe [6] increased to 5004 http://www.sanger.ac.uk/Projects/S_pombe/genome_stats.shtml.

Although A. gossypii was reported to contain 4718 protein-coding nuclear genes [13], the genome project of this fungus is now in progress http://agd.unibas.ch/; thus it possibly contains more than 4775 protein-coding genes.