Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primer name | Sequences | Genomic contig | Position of the 5′ nucleotide of the primer |
|---|---|---|---|
| IHH2.1F | CCAAGATCACACAACTGCAC | NT_011255.13 | 552 360 |
| IHH2.1R | ACCTGATAGTCTGACCGAAT | NT_011255.13 | 552 486 |
| IHH2.2F | CACGGAAGGGAAGCAACCAT | NT_011255.13 | 1 594 931 |
| IHH2.2R | TGATCTCACCACTGCACTCC | NT_011255.13 | 1 595 035 |
| IHH2.3F | ATAAATAAAGTGGCCCAGGA | NT_011255.13 | 1 718 816 |
| IHH2.3R | GGGGTCCGGAAACAGGTAG | NT_011255.13 | 1 718 933 |
