Table 1.
Sequences, CD, Tm and binding data of 2′F-ANA modified thrombin-binding aptamers
| Code | Type | Sequencea | Tm (ΔTm)b (°C) | CD typec | Hysterisis in Tmd | Kd (nM)e | t1/2 (h)f |
|---|---|---|---|---|---|---|---|
| PG1 | All DNA | d(GGTTGGTGTGGTTGG) | 46.4 (42) | II | no | 210 | 0.5 |
| 47.4 | 200(6) | ||||||
| PG2 | All 2′F-ANA | d(GGTTGGTGTGGTTGG) | 54.1 (+0.4) | I | yes | 500 | >24 |
| PG3 | 2′F-ANA G-anti | d(GGTTGGTGTGGTTGG) | 53.3 (+1.5) | II | no | >700 | 4.8 |
| PG4 | 2′F-ANA G-anti& loop | d(GGTTGGTGTGGTTGG) | 61.6 (+1.3) | II | no | 500 | 9.4 |
| PG5 | 2′F-ANA G-syn | d(GGTTGGTGTGGTTGG) | 45.4 (– 0.5) | I | yes | >700 | 0.8 |
| PG6 | 2′F-ANA G-syn&loop | d(GGTTGGTGTGGTTGG) | 48.5 (+0.1) | I | yes | >700 | 0.6 |
| PG7 | 2′F-ANA G-quartet | d(GGTTGGTGTGGTTGG) | 50.2 (+0.4) | I | yes | 450 | 4.0 |
| PG8 | 2′F-ANA all-loop | d(GGTTGGTGTGGTTGG) | 56.3 (+1.3) | II | no | 280 | 5.9 |
| PG9 | 2′F-ANA loop | d(GGTTGGTGTGGTTGG) | 57.1 (+1.6) | II | no | 300 | 2.8 |
| PG10 | 2′F-ANA loop | d(GGTTGGTGTGGTTGG) | 51.2 (+0.8) | II | no | 250 | 2.7 |
| PG11 | 2′F-ANA loop | d(GGTTGGTGTGGTTGG) | 56.6 (+1.8) | II | no | 370 | 5.1 |
| PG12 | 2′F-ANA loop | d(GGTTGGTGTGGTTGG) | 59.1 (+2.9) | II | no | 310 | 3.5 |
| PG13 | 2′F-ANA loop | d(GGTTGGTGTGGTTGG) | 51.0 (+0.9) | II | no | 58 | 3.4 |
| PG14 | 2′F-ANA loop | d(GGTTGGTGTGGTTGG) | 50.6 (+0.8) | II | no | 40 | 2.0 |
| P8 | ssDNA control | d(GTCTCTTGTGTGACTCTGGTAAC) | NA | NA | NA | NC | 0.5 |
| H1 | Hairpin control (RNA) | r(GGACUUCGGUCC) | NA | NA | NA | NC | NA |
aCapital and bold letter: 2′F-ANA.
bΔTm is the Tm change per each 2′F-ANA residue between any modified aptamer with the unmodified DNA aptamer (PG1, Tm = 47.4°C); NA: not applicable.
c‘Type I’ CD spectrum refers to a positive CD band at ∼265 nm and a negative band at ∼240 nm that correlates with G-anti conformation in the G-quartet. ‘Type II’ CD refers to a CD spectrum with positive band at ∼295 nm and a negative band at ∼260 nm, which indicates a mixed anti-G and syn-G conformation in the G-quartet. CD was measured in the buffer of 10 mM Tris, pH 6.8, 25 mM KCl (12).
dHysterisis in Tm refers to the hysterisis existing between a heating and cooling process with 0.5°C/min temperature change during Tm measurements.
eKd was roughly estimated from the concentration (nM) where 50% of the maximum binding percentage was observed with a certain aptamer during the thrombin concentrations studied; NC: not calculated.
fHalf-life in 10% fetal bovine serum (FBS) as monitored by 20% polyacrylamide gel electrophoresis.