Table 1.

Summary of DNA oligonucleotides used to prepare the plasmid constructs, molecular masses, extinction coefficients, and yields of the purified IRBP-thioredoxin fusion proteins. Except for module 4, which was cloned directly into the expression plasmid from a previously described cDNA (XenB1) (Gonzalez-Fernandez et al., 1993 J. Cell Sci. 105:7–21), cDNAs for IRBP and its individual modules were amplified by PCR from the full-length cDNA isolated in the present study. For each primer pair, the sense primer is written above the antisense primer. Regions of each primer corresponding to the plasmid multiple cloning segment are: acaaggtacccggggatcct (sense), and cttaaggtcgactctagagg (antisense). For each sense primer, the codon corresponding to the first amino acid residue of each module is underlined. For the antisense primer the stop codon is underlined.

Protein	Primer Sequence or cDNA	Vector (E. coli)	Induction Temp, time*	KDa†	ε (M-1 cm-1)‡	Yield (per liter E. coli)
Full-length IRBP	ttccagccttctttggtaatttatcgtctgccctctaatt	pThioHis (Top10)	30°C, 5 hrs	148	131,420	7 mg (47 nmoles)
Module 1	ttccagccttctttggtaattgaacgcacagcaaggatag	pThioHis (Top10)	20°C, 21 hrs	47	48,010	15 mg (320 nmoles)
Module 2	tctgttacccatgtcttgcatgggatgaaatgcaatgatct	pThioHis (Top10)	30°C, 21 hrs	49	39,640	20 mg (410 nmoles)
Module 3	agtatatttccattagtcaagggctgtacgcagtttaataatgcg	pTrxFus (GI698)	30°C, 5 hrs	50	60,100	22 mg (460 nmoles)
Module 4	XenB1	pTrxFus (GI724)	35°C, 4 hrs	50	48,010	16 mg (320 nmoles)

* Calculated from the translated amino acid sequence including the thioredoxin fusion protein.

† The temperature and duration of protein induction was determined empirically from pilot studies.

‡ Molecular masses and protein extinction coefficients (ε) were calculated from the amino acid sequences and include the thioredoxin fusion protein (Gill and Von Hippel, 1989 Anal. Biochem. 182:319–326).