TABLE 1.
Oligonucleotides used in this work
| Name | Sequence (5′-3′)a | Nucleotide (amino acid) positionsb |
|---|---|---|
| atp660 | ggtcggaaTTCCAATAGCGGTTAAAAGTTG | −83 to −62 of atpC |
| antDOWN | TCATGAGTCTTCTCCTCTCGC | Complementary to 853 to 873 of ant (285ARGEDS290) |
| antUP | GCTGTCGCCATGTCTGGTTCACG | 76 to 98 of ant (26AVAMSGSR33) |
| atpA 107R | GCGGTTGGCGAACTCCACCAG | Complementary to 318 to 338 of atpA (107WWSSPTA113) |
| atpB56 | GACGGGCTTCTTCAGCTCTGTC | Complementary to 169 to 147 of atpB (50DRAEEAR56) |
| atpc18RSmi | CCAAGAGACACACCCATACAGGC | Complementary to 31 to 53 of atpC (11ACMGVSVG18)c |
| atpc18RSor | GCAAGAGATACACCCATACAGGC | Complementary to 31 to 53 of atpC (11ACMGVSVG18)d |
| atpc18RSpn | CCGACAGATACGCCCATACAGGC | Complementary to 31 to 53 of atpC (11ACMGVSVG18) |
| atpWO | gcgcatgcTTAAAGGAGAATTTGTTATGAA | −15 to 5 of atpC (1MN2) |
| pepti101 | GCAGTTATCGTATCTGACCCAGCC | 304 to 327 of spr1284 (102AVIVSDPA109) |
| pepti413R | CGAACCATGTCTCCTGATTGAACGGG | Complementary to 1213 to 1238 of spr1284 (405PVQSGDMVR413) |
| UPatp3 | tcggaagcttAGGAAAAGCGCTTAAGAACA | −651 to −631 of atpC |
| 16SDNAF1 | GAGTTGCGAACGGGTGAGT | 86 to 104 of 16S rRNA |
| 16SDNAF2 | GTGGCGAAAGCGGCTCTCTGG | 719 to 739 of 16S rRNA |
| 16SDNAR1 | AGCGATTCCGACTTCAT | Complementary to 1326 to 1342 of 16S rRNA |
| 16sDNAR2 | CCAGAGAGCCGCTTTCGCCAC | Complementary to 719 to 739 of 16S rRNA |
The 5′ ends of atp660, atpWO, and UPatp3 contained sequences that included EcoRI, SphI, and HindIII restriction sites, respectively, which are underlined. Lowercase letters indicate bases not present in the nucleotide sequence of S. pneumoniae R6.
The nucleotide and amino acid numbering refers to the numbering for the genes and proteins of the S. pneumoniae R6 sequence, with the first nucleotide or amino acid being at position 1.
The nucleotide and amino acid numbering refers to the numbering for the atpC gene and protein of S. mitis NCTC 12261T, with the first nucleotide or amino acid being at position 1.
The nucleotide and amino acid numbering refers to the numbering for the atpC gene and protein of S. oralis NCTC 11427T, with the first nucleotide or amino acid being at position 1.