. 2003 Oct;69(10):6294–6298. doi: 10.1128/AEM.69.10.6294-6298.2003

TABLE 1.

Recombinant 16S rDNA plasmids and strains used in this study

Probe, plasmid, or strain	Sequence^g (5′-3′)
TM7-905	`CCGTCAATTCCTTTATGTTTTA`
pSBG1^a	`----------------------`
pSBG1a^b	`---------G------------`
pSBG1b^b	`----------------------`
pSBG2^a	`----------------------`
pMF1^c	`---------------A------`
A. aquaticus^d	`--------------GA------`
pPE^e	`--A-----------GA----C-`
IO25-136	`GTCTTATCCCTCACTGCAGG`
pSBG1	`--------------------`
pSBG1a	`--------------------`
pSBG1b	`-----------G--------`
pSBG2	`--CAA-------------C-`
pMF1	`TCGC------AAT---AGA-^f`
A. aquaticus	`AAA----T--GT--GATT--^f`
pPE	`-GT-AT-----A-T-A----^f`

Accession numbers AY144353 (pSBG1) and AY144354 (pSBG2).

Created through site-directed mutagenesis of pSBG1.

Created from M. felifaucium ATCC 43428.

ATCC 25396.

Created from P. endodontalis ATCC 35406.

Source: Ribosomal Database Project (9).

The sequences of oligonucleotide probes TM7-905 and IO25-136 are compared with the corresponding sequences at the probe hybridization sites in the plasmids and strain. Only the nucleotides that differ from those of the probe sequences are shown.