Table 2.
Exon/nucleotide | Amino acid | Screening method | Case* |
---|---|---|---|
5 | H141Q† | ASO‡ | 1F |
422insA | STOP at 33 aa away | ATGCCACAACCCTGCCAC 62 | |
ATGCCACACCCTGCCAC 60 | |||
5 | N166I† | ASO‡ | 1U |
497delATAC | STOP at 48 aa away | TCAGCAATACGTTGGTCT 48 | |
TCAGCAAATACTACGTTG 45 | |||
10 | S470Q† | ASO‡ | 2F |
1408delAG | STOP at 1 aa away | CAGAGCAGTAGTGAGGAG 48 | |
CAGAGAGCAGTAGTGAGGAG 53 | |||
16 | PR830–831PG§ | ASO‡ | 1F |
2490delC | STOP at 42 aa away | CCAAGGAGTCCCCAGGAA 53 | |
CCAAGGAGTCCCCCAGGAA 55 | |||
16 | TG842–843TA§ | Eco0109I (nl)¶ | 1F |
2526delAG | STOP at 11 aa away | ||
16 2552delA and 2561delA | K851S‖ STOP at 13 aa away | ASO for 2552delA‡ CAGGCAGGGAGCAGGA 48 CAGGCAGGGAAGCAGG 48 SfaNI for 2561delA | 1S |
16 2565delAG | SG855–856SE§ STOP at 9 aa away | DdeI (nl)¶ | 1F, 1S |
ins, insertion; del, deletion; STOP, termination codon; aa, amino acid.
The number of familial (F) and sporadic (S) cases in which mutations occurred is designated. If it is unknown whether a case is familial or sporadic because relatives are unavailable, it is designated as U.
The amino acid change indicates the first amino acid that is substituted. All subsequent amino acids are changed as a result of the frameshift.
ASO primer sequences in 5′ to 3′ orientation are listed with Tm °C used to wash membranes. The top oligonucleotide hybridizes to the mutant sequence and bottom oligonucleotide hybridizes to the normal sequence.
The amino acid change indicates (i) the amino acid in which a frameshift occurred without substitution and (ii) the next amino acid that is substituted. All subsequent amino acids are changed as a result of the frameshift.
Restriction enzymes used to detect mutant sequences are listed. (nl) indicates that the enzyme digests the normal, not the mutant sequence.
The amino acid change indicates the result of both mutations in the same gene.