Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Variants of non-quadruplex forming sequence 3m which occur upstream of known genes
| Gene ensembl ID <- - - - - - - | | Number of bases from TSS | Sequence | Number of bases from TSS | Gene ensembl ID |- - - - - - - - -> |
|---|---|---|---|---|
| ENSG00000160145 | 61150 | AGGGCGGGCGTTGGGCGGCGGG | 53107 | ENSG00000065371 |
| ENSG00000202265 | 28176 | AGGGTGGGGGCTGGGCGGCGGG | 134617 | ENSG00000195069 |
