TABLE 2.
Oligonucleotide probes used in this study
| Microorganism | Probe | Sequence (5′-3′)a | Length (mer) | Tm (°C) | Locationb | GenBank accession no.c |
|---|---|---|---|---|---|---|
| E. floccosum | Epflo2c | CCATAGGTGGTTCAGTCTGAGCGT | 24 | 61.0 | 280-303 (1) | AY213646 |
| M. audouinii | Miaud3b | CGACCGTCCCCCCCCAATAAC(tttttttttttttt)d | 21 | 62.8 | 566-586 (2) | AJ252333 |
| M. canis | Mican2g | CCAACTCCCCAGTAACCACCCACC(ttttttttttt) | 24 | 63.1 | 517-540 (2) | AY213657 |
| M. cookei | Micok4 | GCCTTGACTGGACTCCTTTGTCCGTTAAATe | 30 | 65.0 | 152-181 (2) | AY830116 |
| M. ferrugineum | Mifer1c | CCCCTCCCCAACAACCACCCAC(tttttttt) | 22 | 64.9 | 677-698 (2) | AJ252338 |
| M. gallinae | Migal3 | GGCCTCGTTTCAATAATTGTCGTTAGAGAATe | 31 | 62.6 | 536-566 (2) | AJ000620 |
| M. gypseum | Migyp3b | CGGTTTTCTGGCCTAGTTTTAGTTAGG | 27 | 58.2 | 572-598 (2) | AJ970141 |
| Migyp5b | CCTAGTTTCCGTCAGAGATGTATTT | 25 | 52.2 | 544-568 (2) | AJ000621 | |
| M. nanum | Minan1 | AGGAACGATCAAAACACGCGAACACe | 25 | 62.1 | 157-181 (1) | AJ970149 |
| M. persicolor | Miper2 | TGGCCTAGTTTTGGTCAAGGAC(tttttttt) | 22 | 54.8 | 590-611 (2) | AJ000615 |
| T. mentagrophytes | Trmen2d | GCCCCCGTCTTTGGGGGTGCG(ttttttttttttttttt) | 21 | 69.6 | 507-527 (2) | Z97999 |
| Trmen3g | ATAGGGACCAACGTTCCGTCAGGG | 24 | 62.9 | 82-105 (1) | Z98016 | |
| T. rubrum | Trrub3 | GCAGCCAATYCAGCGCCCT(ttttttttttt) | 19 | 60.8 | 698-716 (2) | AF170472 |
| Trrs1c | CAGACACCAAGAAAAAATTCTCTG(tttttt) | 24 | 51.9 | 198-221 (1) | AJ222626 | |
| T. schoenleinii | Trsch2b | CGAATGGGCGCAACAAACCA(ttttttt) | 20 | 61.1 | 575-594 (2) | Z98011 |
| T. soudanense | Trrs1c | CAGACACCAAGAAAAAATTCTCTG(tttttt) | 24 | 51.9 | 198-221 (1) | AJ222626 |
| T. terrestre | Trter1 | AAACACGGTCTTAACTGACCATCTAGG | 27 | 57.2 | 598-624 (2) | AJ877214 |
| Trter6b | TTAACCAAAGTCCCCCAGG(tttttttttttttttt) | 19 | 51.4 | 597-615 (2) | AJ877213 | |
| T. tonsurans | Trton1e | TCCGGCTTTCTAGGCGA(tttttttttttttttttt) | 17 | 51.6 | 545-561 (2) | AY213690 |
| T. verrucosum | Trver2e | TAGGGATCAGCGTTCCATCA(ttttttttttttttt) | 20 | 52.9 | 82-101 (1) | Z98003 |
| T. violaceum | Trvio1c | CAGACACCAAGGAAAATTCTCTG(ttttttt) | 23 | 52.3 | 277-299 (1) | AJ270811 |
| Positive control | PC | GCATCGATGAAGAACGCAGC(ttttttttt) | 20 | 55.7 | 5.8S rRNA gene | EF134625 |
a
Y stands for C or T.
b
The location of probe is shown by the nucleotide number of either ITS-1 or ITS-2; the number (1 or 2) in parentheses indicates the ITS region from where the probe was designed.
c
GenBank accession numbers with a prefix of AY were determined in our laboratory and submitted to GenBank.
d
Indicates that 6 to 18 bases of thymine were added to the 3′ end of the probe.
e
Probes were described previously by Hsiao et al. (14).