Table 6.
Primers for PCR amplification and sequencing reactions of two nuclear DNA fragments from Rhizoctonia solani AG-3 PT and TB
| Loci | Product size | Oligo | Length | Tm (°C) | GC% | Sequence (5' to 3') |
| pP42F a | 401 | F119L | 19 | 60.4 | 57.9 | GTTGGATCACGTCGCTCAG |
| F518R | 20 | 59.7 | 55.0 | TAGTATGGGATACCCACGCC | ||
| pP89b | 1090 | F02 | 21 | 62.3 | 52.4 | TTTGAGGAAGAACGCGTACGC |
| R10 | 21 | 60.7 | 42.9 | TGTCATTGAAAATACGGCCGA | ||
| Internal | L253 | 22 | 59.9 | 50.0 | GTGTGTACTTGTTGGGGAGACA | |
| primers | R790 | 22 | 59.7 | 45.5 | GGTCGTGGGCAAATCTTAATAC |
a Similar to lsc2p gene encoding for beta subunit of succinyl-CoA ligase (synthetase; ATP-forming; a mitochondrial enzyme of the TCA cycle) localized at nuclear chromosome VII from Saccharomyces cerevisiae, accession 6321683 deposited at GenBank (BLASTX2.2.3 score of 89.0 and E-value of 9e-31) or succinyl-CoA ligase [GDP-forming] beta-chain, hydrogenosomal precursor (succinyl-CoA synthetase, beta chain) from Neocallimastix frontalis, accession 9789854 (BLASTX2.2.3 score of 99 and E-value of 3e-33)
b Similar to crm1 gene, encoding for chromosome region maintenance protein 1 or exportin 1 from Schizosaccharomyces pombe, accession 19856107 (BLASTX2.2.3 score of 291 and E-value of e-101)