Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study
| Primer | Sequence |
|---|---|
| UPC2-A2 | gaggactgaaactggactggagc |
| UPC2-C | ctgcagttctttttgtatttgcattacacataaaaaaaaaccacctgacgtctaagaaacc |
| SEC18-B1 | ctatcccagttgcaacagcgg |
| SEC18-C | taatgagcgcgctaaatagttgaatattttatctttaattcacctgacgtctaagaaacc |
| PSD1∷URA-f | ggtcgttattttttgaagaagaaggaaaagcaaagccagcgattcggtaatctccgaaca |
| PSD1∷URA-r | tatacagcaaaataatgctaactttacatatgattgctt ttagttttgctggccgcatc |
