Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Construction of plasmids. The sequence of the primers used for the PCR were as follows: oMP146, AGCTTCCATATGAAGTTCTACCGATGCAGCT; oMP148, TCAGGGGGATCCTCACGAAGCCATAAGCGCTTGCGAG; and oMP147, CGACTTCATATGGTTAGCGGTTCGAGCAATG (obtained from Isogen, Maarssen, The Netherlands).
