Mutations in the DHCR7 gene of patients with the
SLOS. (A) Structure of the gene. Noncoding (open boxes) and
coding exons (filled boxes) are shown. Restriction enzyme cleavage
sites (A, AccI; B, BamHI; H,
HindIII; S, SpeI; X, XhoI) and mutations
are indicated. (B-E) Families with SLOS.
The index patient is indicated by the arrow. Heterozygotes and
homozygotes for mutations in the DHCR7 gene are shown. (B)
Patient SLO8; mutations R404C (▥) and A247V (▤).
(C) Patient SLO1; mutations V326L (▨) and W151X
(▪). (D) Patient SLO6; mutations P51S
(▩) and IVS8–1G>C (▧). (E) patient
SLO2; mutations V326L (▨) and W151X (▪).
(F) Abnormal reverse transcription-PCR-product (arrow) from
fibroblasts from patient SLO5 (lane 2) not seen in cDNA from a control
person (lane 1) and patient SLO9 (lane 3). Oligonucleotides c898s
(GACCACTTCGGGTGGTACCTGGGC) and c999as (GACAGCTGCACGGGGTGGTACACC) are
expected to give a 101-bp product. (G) Consequences of the
splice site mutation found in patient SLO5. The amino acid sequence of
a spliced transcript from a control person (CON AAS) is aligned with
the amino acid sequence (SLO AAS) encoded by the transcript (SLO cDNA)
from patient SLO5’s fibroblasts. The mutation (arrow) and the
premature stop codon (∗) are indicated.