Skip to main content
letter
. 2007 Mar;62(3):279.

Table 1 Toll‐like receptor (TLR)2 and TLR4 restriction fragment length polymorphism analysis*.

Gene polymorphism Restriction enzyme Restriction fragment length (bp) Primer sequence
TLR2 Arg753Gln Msp 1 Wild type (G allele): 104 + 25 F: cattccccagcgcttctgcaagctcc
Arg753Gln (A allele): 129 R: ggaacctaggactttatcgcagctc
TLR4 Asp299Gly Nco 1 Wild type (A allele): 188 F: agcatacttagactactacctccatg
Asp299Gly (G allele): 168 + 20 R: gagagatttgagtttcaatgtggg
TLR4 Thr399Ile Hinf 1 Wild type (C allele): 124 F: ggttgctgttctcaaagtgattttgggagaa
Thr399Ile (T allele): 98 +26 R: ggaaatccagatgttctagttgttctaagcc
Gene polymorphism Allele Controls n = 86 (TLR2) n = 85 (TLR4) Idiopathic bronchiectasis n = 94 Odds ratio (95% CI) p Value
TLR2 Arg753Gln G allele 169 (98.2) 180 (95.7)
A allele 3 (1.8) 8 (4.3) 2.50 (0.65 to 9.59) NS
TLR4 Asp299Gly A allele 162 (95.3) 177 (94.1)
G allele 8 (4.7) 11 (5.9) 1.26 (0.49 to 3.21) NS
TLR4 Thr399Ile C allele 163 (95.9) 177 (94.1)
T allele 7 (4.1) 11 (5.9) 1.45 (0.56 to 3.82) NS

F, forward; R, reverse; TLR, toll‐like receptor.

The table shows the frequencies of TLR2 and TLR4 polymorphisms in patients with idiopathic bronchiectasis and in controls.

*As described previously by Folwaczny et al.7