Table 1. Oligonucleotide sequences used for parallel gene analyses (5′→3′).
| Padlock probe | 5′-End segment | Common sequence | Allele tag | Locus tag | 3′-End segment |
|---|---|---|---|---|---|
| 1216(G/T) | gggattataaagaactgttgc | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | GTTGATGTCATGTGTCGCAC | ttcttctgggctaattacag(c/a) |
| 1366(C/G) | agatgtaggtgtaccatcAgtag | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | TCGTGCCTTGTCATTCGGGA | gggagccacttcctgca(g/c) |
| 1877(C/G) | caatttccttgtcattaaaaa | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | CGTGCAAGTTACCGAGCTGA | gggccagggaagcatgaaag(g/c) |
| 2128(A/G) | gaggagctgaaagacaaggaA | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | TAGATCAGTTGGACTCGATG | Cacgtagaagtaccacccac(t/c) |
| 2495(G/A) | tgacgatatcgccccgctTca | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | GCAGGGAATTGCCGACCATA | acttAcccccagggaccacc(c/t) |
| 2855(G/A) | tctgaacaacaccaaaatcga | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | ACGTTCGTCAAGAGTCGCAT | Atcaacttacaggaaagtat(c/t) |
| 2930(C/T) | tgatggacgtctggaaagcaa | CTCGACCGTTAGCAGCATGAuu | (A1/A2) | CGTTCCTAAAGCTGAGTCTG | ggcaggcaatgcacagcacc(g/a) |
| 2973(G/A) | gtggccagccccagggagcag | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | GAGAGGCCGTCGCTATACAT | ccTaccatgacagccgtggg(c/t) |
| 3207(C/A) | tgttcactgctggcctccgca | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | AAGCCAGATCGACCATCGTA | gtgactgccacgcccaaggg(g/t) |
| 3317(A/T) | ctttgcacccaattccacagc | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | GACGCCGTTATGAGAGTCCA | ggatgccttccacgttgctg(t/a) |
| 3419(T/C) | ctgcatctattcaaaagaggc | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | ATATCGTGTCACAGGTCGTT | tCacagagaaggtctggggg(a/g) |
| 3457(C/T) | ctcacggtttccaatcagcac | CTCGACCGTTAGCAGCATGAtt | (A1/A2) | ATGATGTGCAAAGTGCCGTC | taaTccgttgcgcctcagcc(g/a) |
| 3955(T/C) |
gacagtcctcttggaaaggtA |
CTCGACCGTTAGCAGCATGAtt |
(A1/A2) |
TCCGTCTGTTGAGTTAGGCC |
Taggttgatgcgtatccttc(a/g) |
| Primers and hybridization probes | |||||
| Common primer | TCATGCTGCTAACGGTCGAG | ||||
| Allele 1 specific primer and A1 | CCGAGATGTACCGCTATCGT | ||||
| Allele 2 specific primer and A2 | AGAGCGCATGAATCCGTAGT | ||||
| Hybridization control oligonucleotide | FI/TA – ttttttgaccgctgaagggctt | ||||
Padlock probes were designed to analyze sequence variations within the human ATP7B gene (GenBank accession no. NT_024524). Names of the probe pairs are given as the base pair numbers for the variable nucleotide positions, according to Petrukhin et al. (19), followed by the nucleotide variation in parentheses; allele 1 first, allele 2 second. For each padlock probe pair, the target-complementary sequences are in lower case and bold nucleotides in the target-complementary segments indicate mismatches introduced to prevent undesired self-complementary structures. The alternative nucleotide at the 3′-end of each padlock probe pair corresponds to alleles 1 and 2, respectively. Italic upper case indicates the segments where the common primer hybridizes and normal upper case indicates the locus tag sequences. Tag codes were selected from the GeneFlex™ Tag Array sequence collection (Affymetrix, Santa Clara, CA). The tag sequences specific for alleles 1 and 2 (A1 and A2) at any locus are located between the common and locus tag sequences. The A1 and A2 PCR primers, as well as a hybridization control oligonucleotide, were labeled with FITC or TAMRA. Spotting oligonucleotides for each locus and for the hybridization control are complementary to individual locus tag sequences and to the hybridization control oligonucleotide, respectively, with an additional 3′-(TC)7T-NH2 tail.