Skip to main content
letter
. 2008 Jan;18(1):104–112. doi: 10.1101/gr.6539108

Table 1.

Xenopus tropicalis microRNAs

graphic file with name 104tbl1.jpg

aNew miRNAs species identified in this study.

bPotentially different annotation if seed sequence conservation is considered. xtr-let-7b [UGAGGUAGUAGUUUGUGUAGU] could be xtr-let-7g; xtr-let-7e [UGAGGUAGUAGGUUGUUUAGUU] could be xtr-let-7a.

cSequence [UUGUGUGGAAAUGCUUCUAU] is predicted to be xtr-mir-147; accession number is pending experimental validation.

dSequence [ACCAUCGGCCGUUGACUGUACC]is temporally designated as pre-miRNA xtr-mir-181a-2*; accession number not assigned.