TABLE 2.

Oligonucleotides used in this study

Oligonucleotide	Sequence	Description and gene
BAP3353	CCAATTGGATCCATGGCTCTAAACATAACA	Forward primer for amplification of the complete pcgC gene; contains a BamHI site for cloning
BAP3354	AAATTAGTCGACTTCTAGGGGAATTTTTAAGG	Reverse primer for amplification of the complete pcgC gene; contains a SalI site for cloning
BAP3356	AAAACAGTCGACAAAACCTTATCGAAGCAGGA	Forward primer for amplification of an internal segment of pcgC; contains a SalI site for cloning
BAP3357	TTTTATGTCGACAGCGTCTGATTTTGACCA	Reverse primer for amplification of an internal segment of pcgC; contains a SalI site for cloning