Table III.
Transgene copy no. distribution (percentage of total)a
| Category | PMIb | PPOc | HT-PPOd |
|---|---|---|---|
| Total events | 287 | 45 | 46 |
| One copy | 201 (70%) | 32 (71%) | 26 (57%) |
| Two copies | 62 (21%) | 7.0 (16%) | 11 (24%) |
| >Two copies | 24 (8.0%) | 6.0 (13%) | 9.0 (20%) |
a No. of samples determined to have the indicated copy no. among total events as determined by TaqMan assay. bPMI data cited from Ingham et al. (2001). cEvents containing the pWCO38 construct and tolerant to 1 μm butafenacil or above. dHighly tolerant (>25 μm) pWCO38 events identified from approximately 2,500 events by greenhouse spray. Oligos used for PPO copy no. assay for all pWCO38 events were AtPPO63F, R, and P, respectively, as forward primer (GGACAGAATTCCGGTGTTTGTAG), reverse primer (GCACCGCCCGGAAGA), and probe (CCCGCCAA TCATGTTCAACAGCAAA).