Skip to main content
. 2003 Oct;133(2):736–747. doi: 10.1104/pp.103.026245

Table III.

Transgene copy no. distribution (percentage of total)a

Category PMIb PPOc HT-PPOd
Total events 287 45 46
One copy 201 (70%) 32 (71%) 26 (57%)
Two copies 62 (21%) 7.0 (16%) 11 (24%)
>Two copies 24 (8.0%) 6.0 (13%) 9.0 (20%)

a No. of samples determined to have the indicated copy no. among total events as determined by TaqMan assay. bPMI data cited from Ingham et al. (2001). cEvents containing the pWCO38 construct and tolerant to 1 μm butafenacil or above. dHighly tolerant (>25 μm) pWCO38 events identified from approximately 2,500 events by greenhouse spray. Oligos used for PPO copy no. assay for all pWCO38 events were AtPPO63F, R, and P, respectively, as forward primer (GGACAGAATTCCGGTGTTTGTAG), reverse primer (GCACCGCCCGGAAGA), and probe (CCCGCCAA TCATGTTCAACAGCAAA).