Table I.
Cis-acting elements showing sequence similarities with the EEC
| Organism | Gene | Element | Sequencea | Reference |
|---|---|---|---|---|
| C. reinhardtii | Cah1 | EE-1 | aagattttcaccggttggaaggaggt | This report |
| C. reinhardtii | Cah1 | EE-2 | ccgacttacgaa | This report |
| C. reinhardtii | Mca1 | — | ccgaatttct | Villand et al. (1997) |
| Pea | rbcS-3A | Box III | atcATTTTCact | Kuhlemeier et al. (1987) |
| Human | β-IFN | cactttcacttc | Goodbourn et al. (1985) | |
| Adenovirus type 5 | E1A | — | attttcacttcc | Hearing and Shenk (1983) |
a Nucleotides of the EEC and its corresponding nucleotides are underlined. Consensus sequence of GT-1 binding sites is capitalized.