Table 4.
Case 1: CDR3 Nucleotide and Deduced Amino Acid Sequences of TCR-β Gene Rearrangements Amplified from Micromanipulated T Cells
Clone/sample | Vβ | VNDN | J | Jβ | CDR3 length | |
---|---|---|---|---|---|---|
A278 | 11S1 | CASSESGSG | EKLFFG | 1S4 | 10 | |
TGTGCCAGCAGTGAATCCGGATCTGGC | GAAAAACTGTTTTTTGGC | |||||
7 | 11S1 | CASSESGSG | EKLFFG | 1S4 | 10 | |
TGTGCCAGCAGTGAAAGTGGGTCGGGG | GAAAAACTGTTTTTTGGC | |||||
1 | 6S5 | CASSLSGQG | DYGYTF G | 1S2 | 11 | |
H518 | 13S3 | CATGVS GSGG | EQFFG | 2S1 | 10 |
Sequences A278 and H518 were both amplified from samples of perivascular cells (CD8+ clones 1 and 7 are introduced in Table ). CDR3 sequences are shown from the conserved cysteine of the Vβ to the conserved FG motif of the Jβ elements. Amino acids of the common SGSG motif are shown in bold. CDR3 lengths definition was as in Moss and Bell (reference 66).