TABLE 2.
Oligonucleotides used in this study
| Application | Primer | Sequence (5′-3′)a |
|---|---|---|
| RT | nrdE-RT | cggcgtagacacttgcagga |
| nrdF2-RT | gcctcatagccgaggttcatc | |
| nrdF1-RT | acgatcgaatgcaggctggt | |
| nrdZ-RT | tcggtcacaccaaccgatag | |
| hspX-RT | aaccgccaccgacacagt | |
| sigA-RT | ctgacatgggggcccgctacgttg | |
| Amplification primer pairsb | nrdE-F1 | gatcaaggcacgggagttctt |
| nrdE-R1 | ttggattagcgcgattgacg | |
| nrdF2-F1 | gtctggcgttggttgacgac | |
| nrdF2-R1 | cgtcgtagaggtcctgggtgt | |
| nrdF1-F1 | gaccaccgcgaatacacctg | |
| nrdF1-R1 | cgcatgtagggcaaaacgtc | |
| nrdZ-F1 | cggaccggtgtcgtttctac | |
| nrdZ-R1 | cttggcggtgacgaaatcac | |
| hspX-F1 | ccgagcgcaccgagcagaag | |
| hspX-R1 | ggtggccttaatgtcgtcctcgtc | |
| sigA-F1 | tgcagtcggtgctggacac | |
| sigA-R1 | cgcgcaggacctgtgagcgg | |
| Molecular beacons | nrdE-MB | CCTCGCgagtccggctacccctatatcatgGCGAGG |
| nrdF2-MB | GCAGCGccgagctcaaggactacacctaCGCTGC | |
| nrdF1-MB | GCTCCCatcgactatgcgcacgacttgtacGGGAGC | |
| nrdZ-MB | GGACCCctgtatggctgtgcttgatgtgtcGGGTCC | |
| sigA-MB | CCTCGCgtcgaagttgcgccatccgaGCGAGG |
a
Lowercase letters indicate bases complementary to the M. tuberculosis sequence, whereas uppercase letters indicate bases added to form the stem of the molecular beacon.
b
F1, forward primer; R1, reverse primer.