Table 2.
Nucleotide and Predicted Amino Acid Sequences of TCR-β Chains from PjCHO Ag-specific CD8+ T Cell Clones from Two Different Donors
| Clone | Vβ | CDR3 | Jβ | |||
| Donor A | ||||||
| P4.2 | 8 | C A S S P G T G V D G Y T F | 1.2 | |||
| tgtgccagtagtcctgggacaggggtggatggctacaccttc | ||||||
| Dβ1 | ||||||
| P4.17 | 8 | C A S S L V T G V T D G Y T F | 1.2 | |||
| tgtgccagtagtttggtaacaggcgtgacagatggctacaccttc | ||||||
| P4.52 | 8 | C A S S Q A T A V N G Y T F | 1.2 | |||
| tgtgccagtagtcaagccacagcggtgaacggctacaccttc | ||||||
| Donor B | ||||||
| CP.31 | 8 | C A S S V A T A V T C G Y T F | 1.2 | |||
| tgtgccagtagtgtcgccacagcggtgacatgcgcctacacgttc | ||||||
| CP.38 | 8 | C A S S G T S V A M G Y T F | 1.2 | |||
| tgtgccagtagtgggacagatgtggccatgggttacaccttc | ||||||
| Dβ1 | ||||||
| CP.68 | 8 | C A S S V A T A V T D G Y T F | 1.2 | |||
| tgtgccagtagtgtcgccacagcggtgacagatggctacaccttc |
CDR3 regions run from the consensus cysteine to the first phenylanaline of the “FGXT” motif found in the J region. Identity of Dβ segments was assigned when at least six consecutive bases identical to those of a germline Dβ segment were identified within the junctional region.