Skip to main content
. 1997 Sep 15;186(6):899–908. doi: 10.1084/jem.186.6.899

Table 2.

Nucleotide and Predicted Amino Acid Sequences of TCR-β Chains from PjCHO Ag-specific CD8+ T Cell Clones from Two Different Donors

Clone CDR3
Donor A
P4.2 8 C    A    S  S   P  G    T  G  V     D    G  Y    T   F 1.2
   tgtgccagtagtcctgggacaggggtggatggctacaccttc
Dβ1
P4.17 8 C   A     S  S  L   V    T  G   V     T   D  G   Y    T    F 1.2
   tgtgccagtagtttggtaacaggcgtgacagatggctacaccttc
P4.52 8 C   A     S  S   Q   A   T   A       V    N    G  Y    T   F 1.2
   tgtgccagtagtcaagccacagcggtgaacggctacaccttc
Donor B
 CP.31 8 C   A     S  S  V   A   T   A   V    T   C   G   Y    T    F 1.2
   tgtgccagtagtgtcgccacagcggtgacatgcgcctacacgttc
 CP.38 8 C   A     S  S  G   T   S   V   A     M   G   Y   T   F 1.2
   tgtgccagtagtgggacagatgtggccatgggttacaccttc
Dβ1
 CP.68 8 C   A     S  S  V   A   T   A   V     T   D   G   Y   T   F 1.2
   tgtgccagtagtgtcgccacagcggtgacagatggctacaccttc

CDR3 regions run from the consensus cysteine to the first phenylanaline of the “FGXT” motif found in the J region. Identity of Dβ segments was assigned when at least six consecutive bases identical to those of a germline Dβ segment were identified within the junctional region.