Figure 6.

Gel shift analysis with nuclear cell extracts (20 μg) from AtT-20 cells. A ³²P-labeled ds oligonucleotide (STAT oligo), containing the STAT binding consensus sequence (sense 5′-⁻⁷⁵CAGTTCCAGGAATCGGGGGGC⁻⁵⁵-3′) was used as a probe. Cells were either untreated or treated with 1 nM LIF for 15 min or 30 min. By using nuclear cell extract from 15-min LIF-treated AtT-20 cells, competition of the probe with a 100-fold excess of the unlabeled STAT oligo or the unlabeled STAT oligo mutated at positions −72, −69, −67, and −64, or an unrelated AP-2 oligo could be demonstrated. A presumably unspecific band, unaltered by competition with unlabeled STAT oligo, is shown at the bottom of each lane. Incubation with a STAT-1 antibody or with a STAT-3 antibody abolished DNA binding of specific complexes as evidenced by the absence of specific bands.