Skip to main content
. 1999 Jun 8;96(12):6964–6969. doi: 10.1073/pnas.96.12.6964

Figure 6.

Figure 6

Gel shift analysis with nuclear cell extracts (20 μg) from AtT-20 cells. A 32P-labeled ds oligonucleotide (STAT oligo), containing the STAT binding consensus sequence (sense 5′-−75CAGTTCCAGGAATCGGGGGGC−55-3′) was used as a probe. Cells were either untreated or treated with 1 nM LIF for 15 min or 30 min. By using nuclear cell extract from 15-min LIF-treated AtT-20 cells, competition of the probe with a 100-fold excess of the unlabeled STAT oligo or the unlabeled STAT oligo mutated at positions −72, −69, −67, and −64, or an unrelated AP-2 oligo could be demonstrated. A presumably unspecific band, unaltered by competition with unlabeled STAT oligo, is shown at the bottom of each lane. Incubation with a STAT-1 antibody or with a STAT-3 antibody abolished DNA binding of specific complexes as evidenced by the absence of specific bands.