Table 1.
ODN sequences and differential immune effects of different CpG motifs
| ODN (μg/ml) | DNA sequence (5′ to 3′) | B cell proliferation, (1 × 105)/48 h | mIL-6, pg/ml; 24 h/ (2 × 106 cells) | mIL-12, pg/ml; 24 h/ (2 × 106 cells) | IFN-γ, pg/ml; 48 h/ (2 × 106 cells) | TNF-α, pg/ml; 4 h/ (2 × 106 cells) |
|---|---|---|---|---|---|---|
| None | Baseline | ND | 879 ± 978 | 189 ± 132 | ND | |
| 1911 (6 μg/ml) | TCCAGGACTTTCCTCAGGTT | 7-fold | ND | 6,697 ± 1,589 | 1,158 ± 164 | ND |
| 1911 (0.6 μg/ml) | 3-fold | ND | 925 ± 110 | 113 ± 22 | ND | |
| 1835 (6 μg/ml) | TCTCCCAGCGAGCGCCAT | 4-fold | 46 ± 65 | 5,596 ± 958 | 407 ± 184 | ND |
| 1835 (0.6 μg/ml) | Baseline | ND | 2,452 ± 267 | 366 ± 174 | ND | |
| 1826 (6 μg/ml) | TCCATGACGTTCCTGACGTT | 92-fold | 7,975 ± 356 | 24,032 ± 1,432 | 8,965 ± 1,160 | 1,803 ± 121 |
| 1826 (0.6 μg/ml) | 75-fold | 5,682 ± 365 | 29,953 ± 2286 | 11,378 ± 639 | 579 ± 130 | |
| 1758 (6 μg/ml) | TCTCCCAGCGTGCGCCAT | 47-fold | 2,141 ± 895 | 13,331 ± 436 | 6,299 ± 654 | 286 ± 224 |
| 1758 (0.6 μg/ml) | 7-fold | ND | 8,207 ± 725 | 4,233 ± 1,974 | ND |
Assays were performed by incubating the different ODNs with splenocyte cultures as described in Materials and Methods. Data represent the mean ± SD of triplicate assays and are representative of 3–12 different experiments that gave similar results. TNF-α, tumor necrosis factor α. ND, not detected.