Skip to main content
. 1999 Jun 8;96(12):6970–6975. doi: 10.1073/pnas.96.12.6970

Table 1.

ODN sequences and differential immune effects of different CpG motifs

ODN (μg/ml) DNA sequence (5′ to 3′) B cell proliferation, (1 × 105)/48 h mIL-6, pg/ml; 24 h/ (2 × 106 cells) mIL-12, pg/ml; 24 h/ (2 × 106 cells) IFN-γ, pg/ml; 48 h/ (2 × 106 cells) TNF-α, pg/ml; 4 h/ (2 × 106 cells)
None Baseline ND 879  ± 978 189  ± 132 ND
1911 (6 μg/ml) TCCAGGACTTTCCTCAGGTT 7-fold ND 6,697  ± 1,589 1,158  ± 164 ND
1911 (0.6 μg/ml) 3-fold ND 925  ± 110 113  ± 22 ND
1835 (6 μg/ml) TCTCCCAGCGAGCGCCAT 4-fold 46  ± 65 5,596  ± 958 407  ± 184 ND
1835 (0.6 μg/ml) Baseline ND 2,452  ± 267 366  ± 174 ND
1826 (6 μg/ml) TCCATGACGTTCCTGACGTT 92-fold 7,975  ± 356 24,032  ± 1,432 8,965  ± 1,160 1,803  ± 121
1826 (0.6 μg/ml) 75-fold 5,682  ± 365 29,953  ± 2286 11,378  ± 639 579  ± 130
1758 (6 μg/ml) TCTCCCAGCGTGCGCCAT 47-fold 2,141  ± 895 13,331  ± 436 6,299  ± 654 286  ± 224
1758 (0.6 μg/ml) 7-fold ND 8,207  ± 725 4,233  ± 1,974 ND

Assays were performed by incubating the different ODNs with splenocyte cultures as described in Materials and Methods. Data represent the mean ± SD of triplicate assays and are representative of 3–12 different experiments that gave similar results. TNF-α, tumor necrosis factor α. ND, not detected.