Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2007 Nov 26;7:104. doi: 10.1186/1471-2180-7-104

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

Copyright © 2007 He et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PMC Copyright notice

Southern blot analysis of two A. flavus transformants SOD#5 and SOD#30 after deletion of a putative superoxide gene (GenBank No: CA747446) using an overlap PCR technique with pyr4 as a selectable marker. (A) Genomic DNA digested with Kpn I or BamH I and run on an 0.8% agrose gel. (B) Southern hybridization using N. crassa pyr4 as a probe amplified from plasmid pBSK-pyr4 with the following primer pairs: Pyr-F, 5' TTGGACCACACGAGTCAAG 3' and Pyr4-R, 5' GAAAACGAAATATCCTCCGCC 3'. Lanes 1 & 5 are SOD#5; Lanes 2 & 6 are SOD#30; Lanes 3 & 7 are 3357-5; Lane 4 is blank. Lanes 1–3 digested with Kpn I; Lanes 5–7 digested with BamH I. The two bands in lane 2 suggest multiple integrations in SOD#30.