FIG. 1.

Confirmatory cloning and pyrosequencing results for a specimen with a mixed 3/5 infection. (A) Genotype 5 (ATAAACCCGCTCAATGCCCGGAGATTTGGGCGTGCCCCCGCG). (B) Genotype 3 (AGCAAACCCGCTCAATACCCAGAAATTTGGGCGTGCCCCCGCG). Pyrograms are shown for both HinfI restriction-digested (A) and undigested (B) PCR products from the same specimen. The y axis represents signal intensity in relative light units, and the x axis shows time in minutes and the nucleotide dispensation order. E, dispensation of enzyme mix; S, dispensation of lumogenic substrate. Peak heights represent pyrophosphate release when nucleotides are incorporated to the cDNA strand and are proportional to the numbers of each of the four nucleotides incorporated.