Table 2.
Bacterial strains, plasmids and oligonucleotide primers used in this work
| Strain, plasmid or primer | Relevant properties | Source/reference |
| P. fluorescens | ||
| SBW25 | Wild type strain isolated from sugar beet | [10] |
| SBW25-Sm | Spontaneous Smr derivative of SBW25 | [20] |
| SBW25ΔdapB | DAP/lysine auxotroph of SBW25 | [20] |
| PIL082 | The hxcR-'dapB'lacZ IVET fusion strain of SBW25ΔdapB, Tcr | This work |
| PIL082-1 | ΔdapB DUP(hxcS-psp)::pIVETD, the psp-'dapB'lacZ IVET fusion strain, Tcr | This work |
| SBW25-lacZ | SBW25 marked with 'lacZ in a phage locus | [28] |
| PBR826 | Δpsp or Δpflu2427, SBW25 with a nonpolar deletion of psp, Tcs | This work |
| PBR827 | ΔpstC or Δpflu3317, SBW25 with a nonpolar deletion of pstC, Tcs | This work |
| PBR828 | ΔhxcR or Δpflu2424, SBW25 with a nonpolar deletion of hxcR, Tcs | This work |
| PBR829 | DUP(hxcS-psp)::pUIC3, the psp-'lacZ fusion strain of SBW25, Tcr | This work |
| PBR830 | DUP(pstS-pstC)::pUIC3, the pstC-'lacZ fusion strain of SBW25, Tcr | This work |
| Plasmid | ||
| pRK2013 | Helper plasmid, Tra+, Kmr | [34] |
| pUIC3 | Integration vector with promoterless 'lacZ, oriR6K, Mob+, Tcr | [21] |
| pIVETD | DAP-based IVET vector, pUIC3 with promoterless 'dapB'lacZ, oriR6K, Tcr | [20] |
| pIVETD-13 | pIVETD containing 0.8 kb psp fragment fused to 'dapB'lacZ, oriR6K, Tcr | This work |
| pUIC3-61 | pUIC3 carrying psp-'lacZ fusion, oriR6K, Tcr | This work |
| pUIC3-62 | pUIC3 carrying pstC-'lacZ fusion, oriR6K, Tcr | This work |
| pUIC3-41 | pUIC3 containing 1.6 kb psp deletion fragment, oriR6K, Tcr | This work |
| pUIC3-63 | pUIC3 containing 1.6 kb pstC deletion fragment, oriR6K, Tcr | This work |
| pUIC3-64 | pUIC3 containing 1.9 kb hxcR deletion fragment, oriR6K, Tcr | This work |
| Primera | ||
| psp-1 | GAAGATCTGTTGCGTGCCCTGGAAG | |
| psp-2 | cagcatgcggatccgttgacggaAGCGAGGGTCATGGATACCG | |
| psp-3 | tccgtcaacggatccgcatgctgCGGCAACACCAACGTCTGC | |
| psp-4 | GAAGATCTGCTGCTGGAAATCCACGGT | |
| hxcR-1 | GAGATCTGCGGTAATGGCCACCTATG | |
| hxcR-2 | cagcatgcggatccgttgacggaCGCTGCACCTCGCTGATCGA | |
| hxcR-3 | tccgtcaacggatccgcatgctgTCGACGACGATGTGCGCAGC | |
| hxcR-4 | GAGATCTATGCCAATTCAAACGCGCCA | |
| pstC-1 | GAGATCTTCACCAAGCACCTGGCGG | |
| pstC-2 | cagcatgcggatccgttgacggaAGCCGTGCTTTTCCATGCCT | |
| pstC-3 | tccgtcaacggatccgcatgctgTCGCTGTTTGCACCGGCCAAC | |
| pstC-4 | GAGATCTGCCGGTGGGCAAGACGATTTTC |
a Restriction sites incorporated into the primers are underlined. Complementary sequence designed for the SOE-PCR is indicated by small letters.