TABLE 2.

ASPE species-specific primers and measurement values

Primer	Identified species	ZipCodea	Primer sequence	Signal range (MFI)		Minimum ratiod
				Negativeb	Positivec
P-1	A. calcoaceticus	20	CCTACAAGGAGTAATAAGACATGA	0-26	2,792-3,523	107.4
P-2	A. baumannii	17	GATCTTGGTTTATTAACTTCTGTGATTTCAT	0-445	9,831-11,011	22.1
P-3	Genospecies 3	27	ACCCCAAACAGTCGTCAAC	7-282	6,069-6,256	21.5
P-4	A. haemolyticus	3	GAATACAGTCTAAGTTGACTGGTTTG	0-31	4,916-5,963	158.6
P-5	A. junii	14	GATGAATAATCACAAGCTGCTAG	0-31	14,445-15,698	466.0
P-6	Genospecies 6	22	AACAAGTTGTTCTTCTTGAAGATA	0-45	5,895-7,200	131.0
P-7	A. johnsonii	24	TGCTGAATACAGAAAAACAGAG	0-33	11,210-12,082	339.7
P-8	A. lwoffii	37	CTCTCCTAGTCTCCACCATC	57-336	3,472-3,979	10.3
P-10	Genospecies 10	40	TCCTAGTCTCCACCACTACTAC	8-1,686e	7,457-7,631	4.4
P-11	Genospecies 11	41	GTCAACGGTTCGACTCCGT	0-48	11,084-11,632	230.9
P-12	A. radioresistens	44	AGCAGTAATGCAGAAAAACAGATATG	0-30	5,480-9,747	182.7
P-13	Genospecies 13TU	50	CACCATGACTTTGACTGGTTA	0-361	12,153-13,457	33.7
P-16	Genospecies 16	49	GTTGCAAACTTAATTGCTACTATTC	0-91	4,962-6,162	54.5
UniA	All species	62	AACTAAGCTAAGTCCCCAGC	NAf	9,127-14,703	NA

^aSelected from the Mycobacterium tuberculosis genome (4).

^bRange of MFI for all strains showing negative MFI after subtracting the MFI of the PCR negative-control value for the given primer.

^cRange of MFI for all strains showing positive MFI after subtracting the MFI of the PCR negative-control value for the given primer.

^dThe lowest recorded positive MFI divided by the highest recorded negative MFI.

^eThe genospecies 5 strain cross-reacted with P-10 at about 23% of the signal of the genospecies 10 strain.

^fNA, not applicable.