Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2007 Nov 21;36(3):705–711. doi: 10.1093/nar/gkm1023

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© 2007 The Author(s)

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

PMC Copyright notice

Figure 2. — Primer-template extension assays. In all cases the following primer-template was used: GCAGTCCTAGACGCAG CGTCAGGATCTGCGTCCTATCG(T/U)GG(T/U)GCCTAC. The templates contain a single uracil (thymine in controls) either 7 or 10 bases ahead of the primer-template junction. The polymerases under investigation are shown above each panel. Individual gel lanes are labelled: P (primer); polymerase not added, serves as marker for migration of unextended 16-mer primer. EP (extended primer, only used with Pol γ), chemically synthesized 32-mer corresponding to fully extended primer, serves as marker for full extension. T (thymine), control template lacking uracil. U7/U10; templates containing uracil either 7 or 10 bases ahead of primer-template junction. The archaeal polymerases Mac-Pol and Pfu-Pol fully extend the primer when the template lacks uracil. In contrast, the presence of uracil in the template strand leads to truncated products due to uracil-induced stalling of polymerization. All other polymerase (yeast Pols δ and ε, E. coli PolIII* and mitochondrial Pol γ) fully extend the primer regardless of whether uracil is present or not in the template.