Figure 2.

Cyclin B2 targeting in ES cells. (A) Map of the mouse cyclin B2 gene and of the targeting vector used for homologous recombination. (B) Southern blotting of the NcoI-digested genomic DNA from G-418 resistant colonies with an intron 7 probe (see map) and RT-PCR with exon 3 (CTGTGAAACCAGTGCAGATG) and 6 (ACTGGTGTAAGCATTATCTG) specific oligonucleotides, by using cDNA prepared from RNA of heterozygous or wt ES cells. (C) Southern blots of genomic DNA of homozygous, heterozygous, or wt mice were probed with an exon 4 probe, an intron 7 probe (whose location is indicated in A) or a neo probe as indicated. Northern blots of RNA were prepared from the testes of homozygous, heterozygous, or wt mice and were probed with cyclin B1- and B2-specific probes.