Skip to main content
. 2003 Oct;77(20):10799–10807. doi: 10.1128/JVI.77.20.10799-10807.2003

TABLE 1.

Primers used for construction of mutants

Mutant Primer Sequence Position (nt)
pΔ43-135 1147P 5′ CAAGCAAAGACCCCGGAGGAGCGT 1147-1170 (plus strand)
870M 5′ AGAGAGATGGGGGTTGGTGTT 850-870 (minus strand)
pΔ4-53 901P 5′ TGCCCGTTCTGTCAGTACGACG 901-922 (plus strand)
753-M 5′ TGCAGCCATGACTCCGACATAAAAGG 728-753 (minus strand)
pΔ74-163 1234P 5′ ACCACTAACCTCCAACGGCA 1234-1253 (plus strand)
963M 5′ CTCGCCACGGAGAGACTCTGGGGA 940-963 (minus strand)
pΔ114-163 1234P 5′ ACCACTAACCTCCAACGGCA 1234-1253 (plus strand)
1083M 5′ GTATGTTTCAGGATAGAACCAGGAT 1060-1083 (minus strand)
pLfs 766P 5′ CGATCTGTGCTCGCTGCTGT 766-785 (plus strand)
764M 5′ GAAACCCGTGTTGCAGCCATG 764-744 (minus strand)
1234P 5′ ACCACTAACCTCCAACGGCA 1234-1254 (plus strand)
Ains-1233M 5′ TAGGGAGTGTGAGAGGGGGGGTGGAa 1210-1233 (minus strand)
a

The inserted nucleotide is underlined.