Table 3.
Rhesus MiRNA Gene Families
| MiRNA | Mature MiRNAa | Chr | Strand | Positions in Chrb |
| mml-miR-let-7a-1 | UGAGGUAGUAGGUUGUAUAGUU | 15 | + | 105917273 – 105917352 |
| mml-miR-let-7a-2 | 14 | - | 120554305 – 120554376 | |
| mml-miR-let-7a-3 | 10 | + | 90121100 – 90121173 | |
| mml-miR-7-1 | UGGAAGACUAGUGAUUUUGUUG | 15 | - | 92701750 – 92701859 |
| mml-miR-7-2 | 7 | + | 68219893 – 68220002 | |
| mml-miR-7-3 | 19 | + | 4659068 – 4659177 | |
| mml-miR-9-1 | UCUUUGGUUAUCUAGCUGUAUGA | 1 | - | 135024723–135024811 |
| mml-miR-9-2 | 6 | - | 84955411–84955497 | |
| mml-miR-9-3 | 7 | + | 68995340 – 68995429 | |
| mml-miR-513-1 | UUCACAGGGAGGUGUCAUUUAU | X | - | 145346049–145346177 |
| mml-miR-513-2 | X | - | 145354602–145354730 | |
| mml-miR-513-3 | X | - | 145337083–145337214 | |
| mml-miR-202a | CCACCACCAUGUCUGACACUUU | X | - | 121787204–121787314 |
| mml-miR-202b | CCACCACCGUGUCCGACACCUU | 18 | + | 2383348 – 2383458 |
| mml-miR-202c | CCACCACUGUGUCUGACACCUU | 20 | - | 88058741–88058838 |
| mml-miR-202d | CCACCACCGUGUCUGACACCUU | 4 | + | 3002388–3002492 |
a: Individual genes within a miRNA gene family have the same or different mature miRNA sequences (bold letters indicate the different nucleotides comparing with the mml-miR-202a).
b: position of rhesus miRNA genes in the genome can be found at [27].