Skip to main content
. 2007 Dec 21;74(4):1117–1123. doi: 10.1128/AEM.02012-07

TABLE 1.

Plasmids and oligonucleotide primers used in this study

Plasmid or primer Phenotype or sequencea Source or reference
Plasmids
    pSECE1 Wide-host-range vector, erythromycin resistance marker 25
    pCUS Secretion vector containing signal sequence of amyA gene, derivative of pSECE1 18
    pCUSαA Vector for secreting α-amylase, derivative of pCUS 18
    pAmyA-MCS Vector for secreting α-amylase, cloning sites BamHI-XhoI-HindIII downstream of amyA gene, derivative of pCUS This study
    pMCS-AmyA Vector for secreting α-amylase, cloning sites BamHI-SpeI-XbaI-XhoI upstream of amyA gene, derivative of pCUS This study
    pUC19 Cloning vector, ampicillin resistance marker Takara Bio
    pUC19-CA Vector containing cA from acmA, derivative of pUC19 This study
    pUC19-CA2 Vector containing two cA repeats, derivative of pUC19-CA This study
    pUC19-CA3 Vector containing three cA repeats, derivative of pUC19-CA2 This study
    pCA-AmyA Vector for display of α-amylase to C terminus of cA, derivative of pMCS-AmyA This study
    pCA2-AmyA Vector for display of α-amylase to C terminus of two cA repeats, derivative of pMCS-AmyA This study
    pCA3-AmyA Vector for display of α-amylase to C terminus of three cA repeats, derivative of pMCS-AmyA This study
    pAmyA-CA3 Vector for display of α-amylase to N terminus of three cA repeats, derivative of pAmyA-MCS This study
Oligonucleotide primers
    amyA_F2 5′-CCCGATATCGATGAACAAGTGTCAATGAAAGATGGTA−3′
    amyA_F3 5′-CCGCTCGAGGATGAACAAGTGTCAATGAAAGATGGTACG−3′
    amyA_R 5′-CCCAAGCTTATTTTAGCCCATCTTTATTATAGTTTCCAG−3′
    amyA_R2 5′-CCGCTCGAGTTAGGATCCTTTTAGCCCATCTTTATTATAGTTTCCAG-3′
    cA_F 5′-CGCGGATCCACTAGTGTCGACTCTTCTGCTGGTACTTCTAATTCCGGTGG−3′
    cA_R 5′-ACATGCATGCCTCGAGTTTAATACGAAGATATTGACCAATTAAAATGG−3′
a

For primers, restriction enzyme sites are underlined.