Table 1.
Detail information for MR1-MR5 of the chicken PIT1 gene
| Markers | Source1 | Variation | Region | Primers (forward/reverse) (5' → 3') | Size (bp)2 | Enzyme |
| MR1 | Nie et al. 2005 | 57 bp indel | Intron 2 | PR1 (gtcaaggcaaatattctgtacc/tgcatgttaatttggctctg) | 387 or 330 | / |
| MR2 | Rs13905611 | C/T | Intron 5 | PR2 (ggaccctctctaacagctctc/gggaagaatacagggaaagg) | 599 | TaqI |
| MR3 | Rs13687125 | A/G | Intron 5 | PR2 (as described above) | 599 | MspI |
| MR4 | Rs13687127 | C/T | Intron 5 | PR3 (ggggattttgccactttaggg/tgggtaaggctctggcactgt) | 442 | EcoRI |
| MR5 | Rs13687128 | C/T | Exon 6 (I syn) | PR4 (tgggaagaacagtttatggc/tggctagcttgtaagggaatc) | 483 | TasI |
1 MR1 was reported by Nie et al. (2005); MR2-MR5 were released by NCBI with accession number of Rs13905611, Rs13687125 Rs13687127, and Rs13687128, respectively. The chromosomal sites for MR1-MR5 were nt 96213503–96213559, nt 96221521, nt 96221553, nt 96222619, and nt 96224228, respectively. 2 indicated length of PCR products