TABLE 1.
Probe | GenBank accession no. | Probe sequence (5′-3′) | Probe signal (MFI)a
|
Minimum ratiob | |
---|---|---|---|---|---|
Negative range | Positive range | ||||
Bac | AY950630 | GAGAACCAGACTAAAGTTTCAA | 0-32 | 136 | 3.8 |
Dd | X62918 | AAAAAACGGTCAAAGCGGAGTC | 0-45 | 225-851 | 5.0 |
Ed | X52557 | ACAGATACTGCCTTCTCTTGG | 0-31 | 225-977 | 7.3 |
F | X52080 | ATCTGCAGCAGGTTTCGTGG | 0-25 | 105-311 | 4.2 |
G | AF063199 | CAGGCTGCGTGGCGTTTT | 0-31 | 602-791 | 19.4 |
Hd | X16007 | ACAAAATCTTCTGATTTTAATACAGC | 0-24 | 163-426 | 6.8 |
J | AF063202 | TCTTTTTCCTAACACCGCTTTGAA | 0-28 | 68-102 | 2.4 |
Kd | AF063204 | AACACTGCTTTGGATCGAGCTGTG | 0-41 | 171-271 | 4.2 |
The negative range is the range of the median fluorescence intensity (MFI) for all negative strains after the subtraction of the background for the given primer. The positive range is the range of the MFI for all positive strains after the subtraction of the background for the given primer.
The minimum ratio is the lowest recorded positive value divided by the highest recorded negative value. A minimum ratio of >2 is used as the threshold for defining positive events.
The C. trachomatis type-specific probe Ba has previously been published (13).
These C. trachomatis type-specific probes, D, E, H, and K, have previously been published (11).