Skip to main content
. 2007 Jul 12;583(Pt 3):923–943. doi: 10.1113/jphysiol.2007.133710

Table 1.

PCR primers and restriction enzymes used

mRNA Primer position Forward primer sequence Reverse primer sequence PCR product size (pb) Restriction enzyme Position of site Fragment size (pb)
Calbindin 249 AGGCGCGAAAGAAGGCTGGAT 433 EcoR1 173 260
680 TCCCACACATTTTGATTCCCTG 170
Calretinin 157 GCTGACGGAAATGGGTACAT* 210 Mbo1 183 180
367 CAAGGAAATTCTCTTCGGTCGG*
Parvalbumin 171 AAGAACCCGGATGAGGTGAAG* 360 EcoR1 187 190
531 ATGGCGTCATCCGAGGGC* 170

For each mRNA coding for the three calcium-binding proteins, the table gives the starting position of the primers in the sequence, the primer sequences (5′ to 3′), the size of the amplified product (in base pairs), the characteristic restriction enzymes used to check the specificity of the product, the position of the restriction enzyme cut site, and the size of the cut fragments (in base pairs). The compatibility of primers was assessed with the Oligo software. Note that the primers are specific for cDNA amplification and that no genomic DNA amplification was observed.

*

(Primers designed by Cordero-Erausquin et al. 2004).