TABLE 1.

Primer sequence and localization

Primer pair	Primer name	Sequence	Localization	Amplification product
Pair 1	1f	tcagaaagtgagataagaaaagacaagc	Lgals4 and Lgals6 intron 4	Lgals4, 305 bp
	1r	gccccagtgaccaaggtattaagc	Lgals4 and Lgals6 intron 4	Lgals6, 82 bp
Pair 2	2f	acataggacccagtgtctgagaagg	Lgals6 intron 4	Lgals6, 142 bp
	2r	atccaacatgtcttcatccctttcc	Lgals6 intron 4
Pair 3	3f	taagatttcacttctttgcccaaactgtcc	Lgals4 and Lgals6 intron 3	Lgals4, ∼2000 bp
	3.1r	tcacagagatccacttgcctctagttctcc	Lgals4 intron 4	Lgals6, ∼1800 bp
	3.2r	atccaacatgtcttcatccctttcccaacc	Lgals6 intron 4
Pair 4	4f	gttacatagcgtgtggggtcagg	Lgals4 5′-UTR	Lgals4, 1013 bp
	4r	agttgatgacaaagttcctggctgt	Lgals4 exon 8–9's junction
Pair 5	5f	ggtacaaccctccacagatgaacac	Lgals4 exon 6	Lgals4, 522 bp
	5r	aactcggggatctttctgcttcc	Lgals4 and Lgals6 3′-UTR
Pair 6	6f	gttcagacattcctgtggcctagc	Lgals4 and Lgals6 5′-UTR	Lgals6, 954 bp
	6r	ggaagatcccaccctgaagttgat	5′ of Lgals6 exon 9
Pair 7	7f	gaaaccaaatatccggccatga	Lgals6 exon 4–7's junction	Lgals6, 505 bp
	7r	cattttattaggagcttagatggaactcg	Lgals4 and Lgals6 3′-UTR