TABLE 1.
Bacterial strains and plasmids and oligonucleotides used in this study
| Strain, plasmid, or oligonucleotide | Relevant marker(s) or sequence (5′→3′) | Reference, source, or function |
|---|---|---|
| Strains | ||
| Gordonia species | ||
| G. polyisoprenivorans strain VH2 | Poly(cis-1,4-isoprene)-degrading wild type | 2 |
| G. polyisoprenivorans strain Y2K | Poly(cis-1,4-isoprene)-degrading wild type | 2 |
| G. polyisoprenivorans mutant A12 | lcpVH2 disruption mutant of G. polyisoprenivorans strain VH2; Kmr | This study |
| G. polyisoprenivorans mutant A17 | lcpVH2 disruption mutant of G. polyisoprenivorans strain VH2; Kmr | This study |
| G. polyisoprenivorans mutant A29 | lcpVH2 disruption mutant of G. polyisoprenivorans strain VH2; Kmr | This study |
| G. polyisoprenivorans mutant A34 | lcpVH2 disruption mutant of G. polyisoprenivorans strain VH2; Kmr | This study |
| G. alkanivorans strain 44187 | Poly(cis-1,4-isoprene)-degrading wild type | 26 |
| G. westfalica strain Kb1 | Poly(cis-1,4-isoprene)-degrading wild type | 30 |
| Nocardia farcinica strain IFM10152 | Poly(cis-1,4-isoprene)-degrading wild type | 21 |
| Streptomyces species | ||
| Streptomyces sp. strain K30 | Poly(cis-1,4-isoprene)-degrading and clearing-zone-forming wild type | 33 |
| S. lividans strain TK23 | Non-poly(cis-1,4-isoprene)-degrading and non-clearing-zone-forming wild type | 19 |
| E. coli strains | ||
| XL1-Blue | recA1 endA1 gyrA96 thi-1 hsdR17 (rk− mk+) supE44 relA1 λ−lac [F′ proAB lacIqlacZΔM15 Tn10(Tcr)] | 13 |
| DH5α | F− φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17 (rk− mk+) phoA supE44 λ−thi-1 gyrA96 relA1 | Roche Applied Science, Penzberg, Germany |
| BL21(DE3) | F−ompT hsdSB (rB− mB−) gal dcm lacY1(DE3) | Novagen, Madison, WI |
| Plasmids | ||
| pBluescript SK− | AprlacPOZ′ | Stratagene, San Diego, CA |
| pHC79 | Cosmid (Apr Tcr) | 18 |
| pGEM-T Easy | E. coli cloning vector (Apr T-tailing) | Promega, Madison, WI |
| pGEM-T Easy::lcpVH2::aph | E. coli cloning vector (Apr), containing the cloned gene lcpVH2 from G. polyisoprenivorans strain VH2 with an inserted aph (Kmr) | This study |
| pET-23a | E. coli expression vector (Apr T7 promoter) | Novagen, Madison, WI |
| pET-23a::lcpK30his | E. coli expression vector (Apr T7 promoter), containing the cloned gene lcpK30 from Streptomyces sp. strain K30 | This study |
| pIJSK::lcpK30 | E. coli-Streptomyces shuttle vector, containing the cloned gene lcpK30 from Streptomyces sp. strain K30 (Apr TsrrmelC1 melC2) | Henrike Wernsmann, unpublished data |
| pIJSK | E. coli-Streptomyces shuttle vector (Apr TsrrmelC1 melC2) | This study |
| pIJSK::lcpVH2 | E. coli-Streptomyces shuttle vector, containing the cloned gene lcpVH2 from G. polyisoprenivorans strain VH2 (Apr TsrrmelC1 melC2) | This study |
| pIJSK::lcpVH2::aph | E. coli-Streptomyces shuttle vector, containing the cloned gene lcpVH2::aph from G. polyisoprenivorans mutant A17 (Apr Tsrr KmrmelC1 melC2) | This study |
| pIJSK::lcpKb1 | E. coli-Streptomyces shuttle vector, containing the cloned gene lcpKb1 from G. westfalica strain Kb1 (Apr TsrrmelC1 melC2) | This study |
| Oligonucleotides | ||
| P265f | CGCTGCCCG(AG)CGGA(CT)T(GC)CC(GC) | Degenerated PCR primer based on lcp-homologous sequences, with P701r amplification of a 436-bp PCR product |
| P701r | CTGTG(GC)(AC)AGGTGACCA(AGT)GCATGTCG | Degenerated PCR primer based on lcp-homologous sequences, with P265f amplification of a 436-bp PCR product |
| PVH2_117fBglII | ATATAGATCTGCGAGGTGCGTTGAATACCG | With PVH2_1752rBglII, 1,635-bp lcpVH2 PCR product of G. polyisoprenivorans strain VH2 (BglII restriction sites used for cloning are underlined) |
| PVH2_1752rBglII | ATATAGATCTAGGACCTCGGTTCCGGTGAAC | With PVH2_117fBglII, 1,635-bp lcpVH2 PCR product of G. polyisoprenivorans strain VH2 (BglII restriction sites used for cloning are underlined) |
| PVH2_360f(RT) | TTCAATCAGCGACGGGGCAC | With PVH2_911r(RT), 551-bp PCR product of G. polyisoprenivorans strain VH2 used for RT-PCR |
| PVH2_911r(RT) | AGCATGTCGGCGAGTTTCTGG | With PVH2_360f(RT), 551-bp PCR product of G. polyisoprenivorans strain VH2 used for RT-PCR |
| PVH2_449f | TGACGAAGGCCAGCAGCAGG | With PVH2_2392r, 1,944-bp lcpVH2 PCR product of G. polyisoprenivorans strain VH2 |
| PVH2_2392r | AGGAAGTGCAGTTGCGCGGTC | With PVH2_449f, 1,944-bp lcpVH2 PCR product of G. polyisoprenivorans strain VH2 |
| PKb1_57fBglII | ATATAGATCTCTGGCGTTGATTGGATTCGGG | With PKb1_1789rBglII, 1,732-bp lcpKb1 PCR product of G. westfalica strain Kb1 (BglII restriction sites used for cloning are underlined) |
| PKb1_1789rBglII | ATATAGATCTGCGTCTCCCGTTCAGCAAATGG | With PKb1_57fBglII, 1,732-bp lcpKb1 PCR product of G. westfalica strain Kb1 (BglII restriction sites used for cloning are underlined) |
| PLcp_NtermNdeI | GGCATATGGACGGTTCAGCAG | With PLcp_CtermBamHI, 1,235-bp lcpK30 PCR product of Streptomyces sp. strain K30 (NdeI restriction sites used for cloning are underlined) |
| PLcp_CtermBamHI | AAAGGATCCGGACGGGCGGTTGACGTCCGG | With PLcp_NtermNdeI, 1,235-bp lcpK30 PCR product of Streptomyces sp. strain K30 (BamHI restriction sites used for cloning are underlined) |