Skip to main content
. 2008 May;10(3):265–271. doi: 10.2353/jmoldx.2008.070152

Table 2.

MRM porB VR Genotype Profiles of N. meningitidis Serotyped Strains

porB
Serotype PorB class No. tested VR1 VR2 VR3 VR4
1 3 1 19 Ac 7a 1
1 3 1 19 Ac 341 1
4 3 8 4 D 7 14a
4 3 1 4 B 7 14a
4 3 1 [4] B 7 14a
4 3 1 [4] D 7 14a
4 3 1 4 Db 7 14a
4 3 1 4 B 7 days 14a
14 3 3 19 B 7c 14
2a 2 4 C Eb 2a C
2a 2 1 Cb Eb 2a C
2b 2 1 C Ea 2b C
2b 2 1 C Near Ea* 2b C
15 3 1 A A A Ba
21 3 1 4 D 7b 21
21 3 1 329 313 7b 364
22 2 2 C Ed 5a Db
22 2 1 C Undefined Near 5a Near Ca§

Four samples that gave atypical variant profiles for the serotype are in bold type.

*

Single-nucleotide polymorphism at position 35 (C to T) amino acid change alanine to valine.

DNA sequence AACAATGATGCAAAACGTGTTGCAGTAGGTACTGACAATCCTGTT amino acid sequence NNDAKRVAVGTDNPV.

polymorphisms at positions 9 to 11 (GAT to ACC) with an amino acid change from aspartic acid to threonine.

§

single-nucleotide polymorphism at Ca position 2 (T to A) with an amino acid change from valine to glutamic acid.